ID: 969756462

View in Genome Browser
Species Human (GRCh38)
Location 4:9153297-9153319
Sequence TGGCGCCCGAGGAGAACGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969756452_969756462 15 Left 969756452 4:9153259-9153281 CCAGGTCTCCAGGCAACGCTGCG No data
Right 969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG No data
969756449_969756462 25 Left 969756449 4:9153249-9153271 CCGGCTTCCTCCAGGTCTCCAGG No data
Right 969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG No data
969756454_969756462 7 Left 969756454 4:9153267-9153289 CCAGGCAACGCTGCGGCTCCGCC No data
Right 969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG No data
969756451_969756462 18 Left 969756451 4:9153256-9153278 CCTCCAGGTCTCCAGGCAACGCT No data
Right 969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG No data
969756448_969756462 26 Left 969756448 4:9153248-9153270 CCCGGCTTCCTCCAGGTCTCCAG No data
Right 969756462 4:9153297-9153319 TGGCGCCCGAGGAGAACGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969756462 Original CRISPR TGGCGCCCGAGGAGAACGCG GGG Intergenic