ID: 969779018

View in Genome Browser
Species Human (GRCh38)
Location 4:9381439-9381461
Sequence CGTCCTGTGCTGCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969779018_969779020 -9 Left 969779018 4:9381439-9381461 CCATGAGGTGGCAGCACAGGACG No data
Right 969779020 4:9381453-9381475 CACAGGACGTTTGGCCTTAGCGG No data
969779018_969779025 27 Left 969779018 4:9381439-9381461 CCATGAGGTGGCAGCACAGGACG No data
Right 969779025 4:9381489-9381511 GAATCACTGAAATTCAGGTGTGG No data
969779018_969779021 -6 Left 969779018 4:9381439-9381461 CCATGAGGTGGCAGCACAGGACG No data
Right 969779021 4:9381456-9381478 AGGACGTTTGGCCTTAGCGGTGG No data
969779018_969779024 22 Left 969779018 4:9381439-9381461 CCATGAGGTGGCAGCACAGGACG No data
Right 969779024 4:9381484-9381506 AGTCTGAATCACTGAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969779018 Original CRISPR CGTCCTGTGCTGCCACCTCA TGG (reversed) Intergenic
No off target data available for this crispr