ID: 969782613

View in Genome Browser
Species Human (GRCh38)
Location 4:9421010-9421032
Sequence ATGCAAACCTAAAATTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969782611_969782613 14 Left 969782611 4:9420973-9420995 CCAAAAATATTTTGAATATTAGT No data
Right 969782613 4:9421010-9421032 ATGCAAACCTAAAATTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969782613 Original CRISPR ATGCAAACCTAAAATTATTA AGG Intergenic
No off target data available for this crispr