ID: 969785147

View in Genome Browser
Species Human (GRCh38)
Location 4:9451921-9451943
Sequence GCTCGTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969785142_969785147 -7 Left 969785142 4:9451905-9451927 CCACCCCACTTCAGCAGCTCGTT No data
Right 969785147 4:9451921-9451943 GCTCGTTTACGACCCAAAACGGG No data
969785141_969785147 -2 Left 969785141 4:9451900-9451922 CCATTCCACCCCACTTCAGCAGC No data
Right 969785147 4:9451921-9451943 GCTCGTTTACGACCCAAAACGGG No data
969785143_969785147 -10 Left 969785143 4:9451908-9451930 CCCCACTTCAGCAGCTCGTTTAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 969785147 4:9451921-9451943 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969785147 Original CRISPR GCTCGTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr