ID: 969785645

View in Genome Browser
Species Human (GRCh38)
Location 4:9455099-9455121
Sequence AAGGACCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969785639_969785645 25 Left 969785639 4:9455051-9455073 CCGTATGTCTTTTGAAACTTTCA No data
Right 969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969785645 Original CRISPR AAGGACCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr