ID: 969786863

View in Genome Browser
Species Human (GRCh38)
Location 4:9465192-9465214
Sequence AAGGACAGTTCAGTGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969786855_969786863 10 Left 969786855 4:9465159-9465181 CCTGTTCTCCGTGGTCATGGCCC No data
Right 969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG No data
969786861_969786863 -10 Left 969786861 4:9465179-9465201 CCCAGCAGAGGGGAAGGACAGTT No data
Right 969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG No data
969786856_969786863 2 Left 969786856 4:9465167-9465189 CCGTGGTCATGGCCCAGCAGAGG No data
Right 969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969786863 Original CRISPR AAGGACAGTTCAGTGAGTGT AGG Intergenic
No off target data available for this crispr