ID: 969787900

View in Genome Browser
Species Human (GRCh38)
Location 4:9473623-9473645
Sequence TTTACTCTCCGCAGCACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969787900_969787917 29 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787917 4:9473675-9473697 TCTTGGGAACCCCGTGGCATGGG No data
969787900_969787905 -2 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787905 4:9473644-9473666 AAGAGCCAGCCAGCCCCTCTTGG No data
969787900_969787911 12 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787911 4:9473658-9473680 CCCTCTTGGCCTCTGGCTCTTGG No data
969787900_969787913 13 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787913 4:9473659-9473681 CCTCTTGGCCTCTGGCTCTTGGG No data
969787900_969787915 23 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787915 4:9473669-9473691 TCTGGCTCTTGGGAACCCCGTGG No data
969787900_969787916 28 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787916 4:9473674-9473696 CTCTTGGGAACCCCGTGGCATGG No data
969787900_969787918 30 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787918 4:9473676-9473698 CTTGGGAACCCCGTGGCATGGGG No data
969787900_969787907 5 Left 969787900 4:9473623-9473645 CCCCCCGTGCTGCGGAGAGTAAA No data
Right 969787907 4:9473651-9473673 AGCCAGCCCCTCTTGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969787900 Original CRISPR TTTACTCTCCGCAGCACGGG GGG (reversed) Intergenic
No off target data available for this crispr