ID: 969789067

View in Genome Browser
Species Human (GRCh38)
Location 4:9479509-9479531
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969789061_969789067 9 Left 969789061 4:9479477-9479499 CCTTTCAAGTGCATGGAGCATGA No data
Right 969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969789067 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic