ID: 969789067

View in Genome Browser
Species Human (GRCh38)
Location 4:9479509-9479531
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 28, 1: 27, 2: 19, 3: 18, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969789061_969789067 9 Left 969789061 4:9479477-9479499 CCTTTCAAGTGCATGGAGCATGA No data
Right 969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG 0: 28
1: 27
2: 19
3: 18
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
907024677 1:51104649-51104671 AAGGGCCAATTGTAAGCTGGAGG + Intronic
908435793 1:64104614-64104636 CAGGGCCTATTGAAGGGTGGGGG - Intronic
909004663 1:70261108-70261130 ATGGACCTATTGAATTTTGGGGG - Exonic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG + Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
918755721 1:188337839-188337861 AAGGGCCTCTAGAATTTTGGAGG - Intergenic
921676607 1:217983153-217983175 AAGGGCCTAGTGAGCTGTTGAGG + Intergenic
921721415 1:218475954-218475976 AAGGGCTTGTTGATTTCTGGAGG + Intergenic
922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG + Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG + Intergenic
1063952329 10:11234836-11234858 AAGTGCCTTTTTAACTCTGCAGG - Intronic
1064394683 10:14972102-14972124 AAGAATCCATTGAACTCTGGAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064709362 10:18108048-18108070 AAGAGTCTCTTGAACCCTGGAGG - Intergenic
1064763808 10:18650590-18650612 AAGTAACTATTGAAATCTGGAGG - Intronic
1065945017 10:30598266-30598288 AAGGGCCTATTAAACACAGCCGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066477219 10:35759471-35759493 AAGGGCCTATTCAAATATGTGGG - Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1071434767 10:85637445-85637467 CAAGGCCTATAGAACTCAGGAGG + Intronic
1075548741 10:123376611-123376633 AAGTCCTTATTGATCTCTGGTGG - Intergenic
1075776211 10:124990615-124990637 AAGGGTCCATTGTACTCTGTTGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085961301 11:81465748-81465770 AAGGGCCACTTGAACTGGGGAGG + Intergenic
1089266756 11:117269297-117269319 AAGGTTCTTTTGAACTTTGGGGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1098033451 12:66278446-66278468 AAGGTGCTAATGAACTCTGTTGG + Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1100339899 12:93668888-93668910 AAGTGCCTATTGAACTCCAGTGG + Intergenic
1101129771 12:101676659-101676681 AAGGGTCTATTGAGCCCGGGAGG + Intronic
1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG + Intergenic
1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG + Intronic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1105869422 13:24491029-24491051 GAGGATCTATTGAACTCAGGAGG - Intronic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1107355146 13:39558411-39558433 AATGTCCTATTGAACTTTGCTGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1110740255 13:78987016-78987038 AAGGGCCAATTGAGCTCTATAGG - Intergenic
1112190174 13:97169273-97169295 AAGGGGCTAATCAACTCAGGTGG + Intergenic
1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG + Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1118527892 14:66666429-66666451 TAAAGCCTATTTAACTCTGGTGG - Intronic
1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG + Intronic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG + Intergenic
1131417126 15:92270003-92270025 AAGAGCCTTTTGAAATCTGAGGG - Intergenic
1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG + Intronic
1145688621 17:26706801-26706823 AAAGGAATATTCAACTCTGGGGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1147495582 17:40912110-40912132 AGGGCCCTATTGACCTTTGGTGG + Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG + Intronic
1156099383 18:33575620-33575642 ACATGCCAATTGAACTCTGGAGG + Intergenic
1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG + Intergenic
1162195892 19:8984417-8984439 AAGGGCCTATTGGAGGGTGGAGG + Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1164624799 19:29719060-29719082 AAGAGTCTCTTGAACTCGGGAGG + Intergenic
1165929160 19:39344853-39344875 AAGGGTCTCTTGATCTCTGAAGG - Intronic
1166976526 19:46608190-46608212 AAGGCCTCCTTGAACTCTGGGGG - Exonic
1167947121 19:52997217-52997239 AACTGCCTATTGCACACTGGAGG - Intergenic
927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG + Intergenic
929152738 2:38762013-38762035 AAGAGTCTCTTGAACTCGGGAGG - Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
930773066 2:55147156-55147178 AAGAGCCCATGGAACTCTAGAGG + Intergenic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
936479865 2:112876397-112876419 TAGAGATTATTGAACTCTGGAGG + Intergenic
939759233 2:146153772-146153794 AAGTACCTATTGTACTCTAGGGG + Intergenic
940345437 2:152623524-152623546 AATGGCCTTTGTAACTCTGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG + Intergenic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
953975110 3:47376526-47376548 AAGGGCCCATCCAACTCTGCTGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959141991 3:102496831-102496853 TGGGGCCTATTGGACTGTGGAGG + Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG + Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
964814283 3:160700545-160700567 AAGGGCGTATTGACCTCTAAGGG - Intergenic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971013376 4:22463301-22463323 AAGGGACTAAGGAACCCTGGAGG - Intronic
974656890 4:64836858-64836880 AAGGGTCGCTTGAACTCGGGAGG - Intergenic
979352816 4:119665481-119665503 AAGGCTCTAGTGAACTCTGATGG + Intergenic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
979738010 4:124112779-124112801 AGGGGCTAATTGAACTCAGGAGG - Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
985009072 4:185563858-185563880 CAGGGCCAAGAGAACTCTGGAGG - Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
990313393 5:54561425-54561447 AAGGACCTCTTGAGCTCAGGAGG - Intergenic
990469340 5:56099460-56099482 AACTGCCTATTCAACTCTGTTGG + Intergenic
992020501 5:72619186-72619208 AAGCGCCTTTTGAATTCTGAAGG - Intergenic
992621245 5:78595408-78595430 AAGGGCTTATAGATTTCTGGTGG - Intronic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
993618298 5:90138441-90138463 AGGGGCCTATAGAGCTCTGAGGG - Intergenic
994980452 5:106868430-106868452 AAGGGCCTAGTGAATAGTGGAGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG + Intergenic
998596325 5:143534244-143534266 AATGGCTTATTGAATTATGGAGG - Intergenic
998606137 5:143636517-143636539 TAGGGCTTATTGGACTTTGGGGG + Intergenic
1000050792 5:157561468-157561490 AAGGGCTTCTGGGACTCTGGGGG - Intronic
1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG + Intergenic
1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG + Intronic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1014166787 6:118233911-118233933 AAGGGTCTCTTGACCTTTGGTGG - Intronic
1014388570 6:120832119-120832141 AAGGGTCTCTTGAGCTCAGGAGG + Intergenic
1017997617 6:159546478-159546500 CAGGGCCTTTTGGACTTTGGTGG - Intergenic
1018051741 6:160015395-160015417 CAGGGCCTTTTTTACTCTGGGGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021620432 7:22545615-22545637 AAGGGCCAAATGAACTCTTCTGG + Intronic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1023166359 7:37347383-37347405 AAGGGACTGTTGACCTCTAGAGG - Intronic
1023337190 7:39182850-39182872 AAGTGCCTATCGGACTCTGATGG - Intronic
1027963023 7:84970787-84970809 AAGGAACTATTGAAATCTTGTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042281819 8:67064168-67064190 CAGGGGCTATTAAACTGTGGGGG - Intronic
1042323455 8:67503384-67503406 GAGGACCTGTTGAACTCAGGAGG - Intronic
1042758811 8:72249288-72249310 AAGGGTTTTTTGAACTCTAGAGG - Intergenic
1046729727 8:117712030-117712052 AAGGGATTATTTAACTCTGATGG - Intergenic
1048088377 8:131209749-131209771 TAGGGCCTATTGGACGGTGGAGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1056785497 9:89589944-89589966 AAAGGCCTTTTCAACTCAGGGGG + Intergenic
1056865849 9:90226845-90226867 GCCTGCCTATTGAACTCTGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG + Intronic
1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG + Intergenic
1190425839 X:50333937-50333959 AAGGGTCTGCTAAACTCTGGGGG - Intronic
1190865158 X:54378297-54378319 GAGGATCTCTTGAACTCTGGAGG - Intergenic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1194875107 X:99177454-99177476 CATGGCCTATTGAAGTATGGAGG + Intergenic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1195437094 X:104857164-104857186 AAATACCTATTGGACTCTGGAGG + Intronic
1198831230 X:140752837-140752859 AAGGGCCGAATTAACTCAGGAGG - Intergenic
1199968952 X:152844493-152844515 AAGGCCTTATTGACCTCTGCTGG - Intronic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic
1202056335 Y:20835335-20835357 AAGGTTATAATGAACTCTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic