ID: 969790251

View in Genome Browser
Species Human (GRCh38)
Location 4:9489452-9489474
Sequence TCTGTGTCCTGGGGGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969790251_969790262 29 Left 969790251 4:9489452-9489474 CCTTGAGCCCCCCAGGACACAGA No data
Right 969790262 4:9489504-9489526 CAGTGTGAGGTCCAGTCCTGTGG No data
969790251_969790257 16 Left 969790251 4:9489452-9489474 CCTTGAGCCCCCCAGGACACAGA No data
Right 969790257 4:9489491-9489513 GCCTCCAGCCCTGCAGTGTGAGG No data
969790251_969790263 30 Left 969790251 4:9489452-9489474 CCTTGAGCCCCCCAGGACACAGA No data
Right 969790263 4:9489505-9489527 AGTGTGAGGTCCAGTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969790251 Original CRISPR TCTGTGTCCTGGGGGGCTCA AGG (reversed) Intergenic
No off target data available for this crispr