ID: 969793365

View in Genome Browser
Species Human (GRCh38)
Location 4:9507468-9507490
Sequence CATGTGGGCCCAACTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969793365_969793378 29 Left 969793365 4:9507468-9507490 CCACCCCCAGTTGGGCCCACATG No data
Right 969793378 4:9507520-9507542 GACAGGGAAGCGCTCTTGGAAGG No data
969793365_969793377 25 Left 969793365 4:9507468-9507490 CCACCCCCAGTTGGGCCCACATG No data
Right 969793377 4:9507516-9507538 CCGAGACAGGGAAGCGCTCTTGG No data
969793365_969793374 12 Left 969793365 4:9507468-9507490 CCACCCCCAGTTGGGCCCACATG No data
Right 969793374 4:9507503-9507525 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969793365_969793373 -3 Left 969793365 4:9507468-9507490 CCACCCCCAGTTGGGCCCACATG No data
Right 969793373 4:9507488-9507510 ATGAAAGAGAGGATATGCAAAGG 0: 42
1: 22
2: 15
3: 41
4: 461
969793365_969793375 13 Left 969793365 4:9507468-9507490 CCACCCCCAGTTGGGCCCACATG No data
Right 969793375 4:9507504-9507526 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969793365 Original CRISPR CATGTGGGCCCAACTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr