ID: 969793804

View in Genome Browser
Species Human (GRCh38)
Location 4:9510277-9510299
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969793798_969793804 8 Left 969793798 4:9510246-9510268 CCTTCAAGTACATGGAGCGTGAT No data
Right 969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG No data
969793797_969793804 9 Left 969793797 4:9510245-9510267 CCCTTCAAGTACATGGAGCGTGA No data
Right 969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969793804 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic