ID: 969797220

View in Genome Browser
Species Human (GRCh38)
Location 4:9535650-9535672
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969797220_969797228 10 Left 969797220 4:9535650-9535672 CCAGGGTGTGTCTGACCCACAGC No data
Right 969797228 4:9535683-9535705 GGGAGAGAAAAGTCTCTCCTAGG No data
969797220_969797229 17 Left 969797220 4:9535650-9535672 CCAGGGTGTGTCTGACCCACAGC No data
Right 969797229 4:9535690-9535712 AAAAGTCTCTCCTAGGTATTTGG No data
969797220_969797223 -10 Left 969797220 4:9535650-9535672 CCAGGGTGTGTCTGACCCACAGC No data
Right 969797223 4:9535663-9535685 GACCCACAGCTCCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969797220 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr