ID: 969801152

View in Genome Browser
Species Human (GRCh38)
Location 4:9566585-9566607
Sequence CTTCCCATCGTTCCAAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969801152_969801156 9 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801156 4:9566617-9566639 TCTGTGTTTAAGGTGAGAAGTGG No data
969801152_969801157 10 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG No data
969801152_969801159 17 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801159 4:9566625-9566647 TAAGGTGAGAAGTGGGGCACTGG No data
969801152_969801154 -1 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801154 4:9566607-9566629 GGAGCTGCCATCTGTGTTTAAGG No data
969801152_969801160 21 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801160 4:9566629-9566651 GTGAGAAGTGGGGCACTGGCTGG No data
969801152_969801158 11 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801158 4:9566619-9566641 TGTGTTTAAGGTGAGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969801152 Original CRISPR CTTCCCATCGTTCCAAACCT TGG (reversed) Intergenic
No off target data available for this crispr