ID: 969801157

View in Genome Browser
Species Human (GRCh38)
Location 4:9566618-9566640
Sequence CTGTGTTTAAGGTGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969801150_969801157 12 Left 969801150 4:9566583-9566605 CCCCAAGGTTTGGAACGATGGGA No data
Right 969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG No data
969801151_969801157 11 Left 969801151 4:9566584-9566606 CCCAAGGTTTGGAACGATGGGAA No data
Right 969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG No data
969801152_969801157 10 Left 969801152 4:9566585-9566607 CCAAGGTTTGGAACGATGGGAAG No data
Right 969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969801157 Original CRISPR CTGTGTTTAAGGTGAGAAGT GGG Intergenic
No off target data available for this crispr