ID: 969809402

View in Genome Browser
Species Human (GRCh38)
Location 4:9636319-9636341
Sequence ACCAAAACTGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969809395_969809402 7 Left 969809395 4:9636289-9636311 CCAGTAGCACCACCTCCTCCAGC No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809397_969809402 -5 Left 969809397 4:9636301-9636323 CCTCCTCCAGCCGCAACCACCAA No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809391_969809402 29 Left 969809391 4:9636267-9636289 CCTGGCCTCTACCCATTAGCTGC No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809396_969809402 -2 Left 969809396 4:9636298-9636320 CCACCTCCTCCAGCCGCAACCAC No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809390_969809402 30 Left 969809390 4:9636266-9636288 CCCTGGCCTCTACCCATTAGCTG No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809392_969809402 24 Left 969809392 4:9636272-9636294 CCTCTACCCATTAGCTGCCAGTA No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809398_969809402 -8 Left 969809398 4:9636304-9636326 CCTCCAGCCGCAACCACCAAAAC No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809393_969809402 18 Left 969809393 4:9636278-9636300 CCCATTAGCTGCCAGTAGCACCA No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data
969809394_969809402 17 Left 969809394 4:9636279-9636301 CCATTAGCTGCCAGTAGCACCAC No data
Right 969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969809402 Original CRISPR ACCAAAACTGTCTCCAGACA TGG Intergenic
No off target data available for this crispr