ID: 969811264

View in Genome Browser
Species Human (GRCh38)
Location 4:9650176-9650198
Sequence CCTCCTGGTGTTATTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969811257_969811264 8 Left 969811257 4:9650145-9650167 CCATCCTTCACAATAGACCTTAA No data
Right 969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG No data
969811258_969811264 4 Left 969811258 4:9650149-9650171 CCTTCACAATAGACCTTAATATT No data
Right 969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG No data
969811260_969811264 -9 Left 969811260 4:9650162-9650184 CCTTAATATTCCCACCTCCTGGT No data
Right 969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969811264 Original CRISPR CCTCCTGGTGTTATTCATTG TGG Intergenic
No off target data available for this crispr