ID: 969817596

View in Genome Browser
Species Human (GRCh38)
Location 4:9698022-9698044
Sequence GAGTGTGACGGAGCCTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969817596_969817607 29 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817607 4:9698074-9698096 CACCACAGGCCTGGTCACATGGG No data
969817596_969817606 28 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817606 4:9698073-9698095 GCACCACAGGCCTGGTCACATGG No data
969817596_969817603 20 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data
969817596_969817598 -10 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817598 4:9698035-9698057 CGTCACACTCTCCGAGAGTACGG No data
969817596_969817600 6 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817600 4:9698051-9698073 AGTACGGCCATCATCTCCCACGG No data
969817596_969817602 15 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817602 4:9698060-9698082 ATCATCTCCCACGGCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969817596 Original CRISPR GAGTGTGACGGAGCCTCCCG AGG (reversed) Intergenic
No off target data available for this crispr