ID: 969817599

View in Genome Browser
Species Human (GRCh38)
Location 4:9698046-9698068
Sequence GGAGATGATGGCCGTACTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969817599_969817602 -9 Left 969817599 4:9698046-9698068 CCGAGAGTACGGCCATCATCTCC No data
Right 969817602 4:9698060-9698082 ATCATCTCCCACGGCACCACAGG No data
969817599_969817607 5 Left 969817599 4:9698046-9698068 CCGAGAGTACGGCCATCATCTCC No data
Right 969817607 4:9698074-9698096 CACCACAGGCCTGGTCACATGGG No data
969817599_969817603 -4 Left 969817599 4:9698046-9698068 CCGAGAGTACGGCCATCATCTCC No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data
969817599_969817606 4 Left 969817599 4:9698046-9698068 CCGAGAGTACGGCCATCATCTCC No data
Right 969817606 4:9698073-9698095 GCACCACAGGCCTGGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969817599 Original CRISPR GGAGATGATGGCCGTACTCT CGG (reversed) Intergenic
No off target data available for this crispr