ID: 969817603

View in Genome Browser
Species Human (GRCh38)
Location 4:9698065-9698087
Sequence CTCCCACGGCACCACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969817595_969817603 21 Left 969817595 4:9698021-9698043 CCCTCGGGAGGCTCCGTCACACT No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data
969817597_969817603 8 Left 969817597 4:9698034-9698056 CCGTCACACTCTCCGAGAGTACG No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data
969817596_969817603 20 Left 969817596 4:9698022-9698044 CCTCGGGAGGCTCCGTCACACTC No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data
969817599_969817603 -4 Left 969817599 4:9698046-9698068 CCGAGAGTACGGCCATCATCTCC No data
Right 969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969817603 Original CRISPR CTCCCACGGCACCACAGGCC TGG Intergenic
No off target data available for this crispr