ID: 969818632

View in Genome Browser
Species Human (GRCh38)
Location 4:9704591-9704613
Sequence CTGCAGTTTAGGAAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969818632_969818634 -9 Left 969818632 4:9704591-9704613 CCTGATCACTTCCTAAACTGCAG No data
Right 969818634 4:9704605-9704627 AAACTGCAGCCCGACCCACCCGG No data
969818632_969818640 9 Left 969818632 4:9704591-9704613 CCTGATCACTTCCTAAACTGCAG No data
Right 969818640 4:9704623-9704645 CCCGGCTCCAGCATCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969818632 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG (reversed) Intergenic
No off target data available for this crispr