ID: 969819737

View in Genome Browser
Species Human (GRCh38)
Location 4:9710757-9710779
Sequence TTTCTTTAAAGAGGCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969819737_969819743 27 Left 969819737 4:9710757-9710779 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 969819743 4:9710807-9710829 GCCCTGCAATGAAATCATGGCGG No data
969819737_969819747 29 Left 969819737 4:9710757-9710779 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 969819747 4:9710809-9710831 CCTGCAATGAAATCATGGCGGGG No data
969819737_969819742 24 Left 969819737 4:9710757-9710779 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 969819742 4:9710804-9710826 ACAGCCCTGCAATGAAATCATGG No data
969819737_969819740 -1 Left 969819737 4:9710757-9710779 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 969819740 4:9710779-9710801 AGATGCCGGTTTGTCGTAGACGG No data
969819737_969819745 28 Left 969819737 4:9710757-9710779 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 969819745 4:9710808-9710830 CCCTGCAATGAAATCATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969819737 Original CRISPR TTTCTTTAAAGAGGCACCTC TGG (reversed) Intergenic
No off target data available for this crispr