ID: 969821582

View in Genome Browser
Species Human (GRCh38)
Location 4:9724825-9724847
Sequence AAACGCTGGTTGTCTAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969821582_969821587 22 Left 969821582 4:9724825-9724847 CCCGTTTTAGACAACCAGCGTTT No data
Right 969821587 4:9724870-9724892 GCCAAATTATGACTCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969821582 Original CRISPR AAACGCTGGTTGTCTAAAAC GGG (reversed) Intergenic
No off target data available for this crispr