ID: 969823626

View in Genome Browser
Species Human (GRCh38)
Location 4:9739659-9739681
Sequence CCTTCTTTGAAGCAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969823622_969823626 24 Left 969823622 4:9739612-9739634 CCAAGAACATACTCACAGTGATT No data
Right 969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG No data
969823623_969823626 -2 Left 969823623 4:9739638-9739660 CCAGCCATTGCTAATCTAAAACC No data
Right 969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG No data
969823621_969823626 25 Left 969823621 4:9739611-9739633 CCCAAGAACATACTCACAGTGAT No data
Right 969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG No data
969823624_969823626 -6 Left 969823624 4:9739642-9739664 CCATTGCTAATCTAAAACCTTCT No data
Right 969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969823626 Original CRISPR CCTTCTTTGAAGCAGAAAGA TGG Intergenic
No off target data available for this crispr