ID: 969826191

View in Genome Browser
Species Human (GRCh38)
Location 4:9760465-9760487
Sequence GCTCGTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826184_969826191 -6 Left 969826184 4:9760448-9760470 CCACCCCTCCCTCGGCAGCTCGT No data
Right 969826191 4:9760465-9760487 GCTCGTTTACGACCCAAAACGGG No data
969826186_969826191 -10 Left 969826186 4:9760452-9760474 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 969826191 4:9760465-9760487 GCTCGTTTACGACCCAAAACGGG No data
969826185_969826191 -9 Left 969826185 4:9760451-9760473 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 969826191 4:9760465-9760487 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826191 Original CRISPR GCTCGTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr