ID: 969826298

View in Genome Browser
Species Human (GRCh38)
Location 4:9761235-9761257
Sequence GGCCTGGAGAAACACCGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826293_969826298 9 Left 969826293 4:9761203-9761225 CCTAAGGAAAACGGCAAAGAGAA No data
Right 969826298 4:9761235-9761257 GGCCTGGAGAAACACCGACCTGG No data
969826292_969826298 10 Left 969826292 4:9761202-9761224 CCCTAAGGAAAACGGCAAAGAGA No data
Right 969826298 4:9761235-9761257 GGCCTGGAGAAACACCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826298 Original CRISPR GGCCTGGAGAAACACCGACC TGG Intergenic
No off target data available for this crispr