ID: 969826576

View in Genome Browser
Species Human (GRCh38)
Location 4:9762804-9762826
Sequence GTATGAGGTCCCAAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826570_969826576 6 Left 969826570 4:9762775-9762797 CCAAACTTTGAAGTATTAGCCAA No data
Right 969826576 4:9762804-9762826 GTATGAGGTCCCAAAGTGGGCGG No data
969826569_969826576 7 Left 969826569 4:9762774-9762796 CCCAAACTTTGAAGTATTAGCCA No data
Right 969826576 4:9762804-9762826 GTATGAGGTCCCAAAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826576 Original CRISPR GTATGAGGTCCCAAAGTGGG CGG Intergenic
No off target data available for this crispr