ID: 969826783

View in Genome Browser
Species Human (GRCh38)
Location 4:9764105-9764127
Sequence CCAGAGGAAGGCGGCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826783_969826789 -9 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826789 4:9764119-9764141 TTCCTCTGGAGTTCTTGTGATGG No data
969826783_969826791 25 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826783_969826792 26 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826792 4:9764154-9764176 TGTTGTCATTGTTCAAGCCAGGG No data
969826783_969826793 27 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826793 4:9764155-9764177 GTTGTCATTGTTCAAGCCAGGGG No data
969826783_969826794 30 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826783 Original CRISPR CCAGAGGAAGGCGGCTCCAG GGG (reversed) Intergenic
No off target data available for this crispr