ID: 969826785

View in Genome Browser
Species Human (GRCh38)
Location 4:9764106-9764128
Sequence TCCAGAGGAAGGCGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826785_969826791 24 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826785_969826789 -10 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826789 4:9764119-9764141 TTCCTCTGGAGTTCTTGTGATGG No data
969826785_969826792 25 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826792 4:9764154-9764176 TGTTGTCATTGTTCAAGCCAGGG No data
969826785_969826794 29 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826785_969826793 26 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826793 4:9764155-9764177 GTTGTCATTGTTCAAGCCAGGGG No data
969826785_969826795 30 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826785 Original CRISPR TCCAGAGGAAGGCGGCTCCA GGG (reversed) Intergenic
No off target data available for this crispr