ID: 969826787

View in Genome Browser
Species Human (GRCh38)
Location 4:9764114-9764136
Sequence ACAAGAACTCCAGAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826787_969826795 22 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data
969826787_969826793 18 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826793 4:9764155-9764177 GTTGTCATTGTTCAAGCCAGGGG No data
969826787_969826791 16 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826787_969826792 17 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826792 4:9764154-9764176 TGTTGTCATTGTTCAAGCCAGGG No data
969826787_969826794 21 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826787 Original CRISPR ACAAGAACTCCAGAGGAAGG CGG (reversed) Intergenic
No off target data available for this crispr