ID: 969826791

View in Genome Browser
Species Human (GRCh38)
Location 4:9764153-9764175
Sequence ATGTTGTCATTGTTCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826783_969826791 25 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826787_969826791 16 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826788_969826791 13 Left 969826788 4:9764117-9764139 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826785_969826791 24 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826790_969826791 9 Left 969826790 4:9764121-9764143 CCTCTGGAGTTCTTGTGATGGCA No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data
969826786_969826791 23 Left 969826786 4:9764107-9764129 CCTGGAGCCGCCTTCCTCTGGAG No data
Right 969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826791 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG Intergenic
No off target data available for this crispr