ID: 969826794

View in Genome Browser
Species Human (GRCh38)
Location 4:9764158-9764180
Sequence GTCATTGTTCAAGCCAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826785_969826794 29 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826783_969826794 30 Left 969826783 4:9764105-9764127 CCCCTGGAGCCGCCTTCCTCTGG No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826790_969826794 14 Left 969826790 4:9764121-9764143 CCTCTGGAGTTCTTGTGATGGCA No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826786_969826794 28 Left 969826786 4:9764107-9764129 CCTGGAGCCGCCTTCCTCTGGAG No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826788_969826794 18 Left 969826788 4:9764117-9764139 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data
969826787_969826794 21 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826794 4:9764158-9764180 GTCATTGTTCAAGCCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826794 Original CRISPR GTCATTGTTCAAGCCAGGGG TGG Intergenic
No off target data available for this crispr