ID: 969826795

View in Genome Browser
Species Human (GRCh38)
Location 4:9764159-9764181
Sequence TCATTGTTCAAGCCAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969826787_969826795 22 Left 969826787 4:9764114-9764136 CCGCCTTCCTCTGGAGTTCTTGT No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data
969826790_969826795 15 Left 969826790 4:9764121-9764143 CCTCTGGAGTTCTTGTGATGGCA No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data
969826785_969826795 30 Left 969826785 4:9764106-9764128 CCCTGGAGCCGCCTTCCTCTGGA No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data
969826788_969826795 19 Left 969826788 4:9764117-9764139 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data
969826786_969826795 29 Left 969826786 4:9764107-9764129 CCTGGAGCCGCCTTCCTCTGGAG No data
Right 969826795 4:9764159-9764181 TCATTGTTCAAGCCAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969826795 Original CRISPR TCATTGTTCAAGCCAGGGGT GGG Intergenic
No off target data available for this crispr