ID: 969828181

View in Genome Browser
Species Human (GRCh38)
Location 4:9774857-9774879
Sequence CCTTATTTGCAGAAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969828181_969828184 -8 Left 969828181 4:9774857-9774879 CCTCATTCCTTCTGCAAATAAGG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 969828184 4:9774872-9774894 AAATAAGGAAAATGACCACCTGG 0: 6
1: 0
2: 6
3: 42
4: 364
969828181_969828185 2 Left 969828181 4:9774857-9774879 CCTCATTCCTTCTGCAAATAAGG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 969828185 4:9774882-9774904 AATGACCACCTGGAAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969828181 Original CRISPR CCTTATTTGCAGAAGGAATG AGG (reversed) Intronic
902279355 1:15362957-15362979 CCTGCCTTGCTGAAGGAATGGGG - Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
904713841 1:32451814-32451836 CATTTTTTGCATATGGAATGAGG + Intergenic
909178000 1:72384121-72384143 CCTAATATCCAGAATGAATGGGG + Intergenic
909238115 1:73178880-73178902 TCTCATCTGCTGAAGGAATGTGG + Intergenic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
910442627 1:87268074-87268096 TTTTCTGTGCAGAAGGAATGAGG + Intergenic
912044063 1:105432702-105432724 ATTTTTTTGCTGAAGGAATGTGG - Intergenic
912481716 1:109986575-109986597 CCTTATAAGCAGAATGATTGAGG + Intronic
914941330 1:152025327-152025349 CATTATTTGCGGTAGGAAAGGGG + Intergenic
916366777 1:164037900-164037922 GGGTATTTGCAGGAGGAATGGGG - Intergenic
916454945 1:164961464-164961486 CCTAATTAGCAGCAGGACTGGGG - Intergenic
916455187 1:164963779-164963801 ACTTATTTTAAGAAGGAATAAGG + Intergenic
916884289 1:169052132-169052154 CCTTACTTCCAGGAGAAATGGGG + Intergenic
917512970 1:175683452-175683474 CCTTTTTTGGAGAAGGATGGTGG - Intronic
917609729 1:176674970-176674992 CCTTTCTTGCAGGAGTAATGTGG + Intronic
917955090 1:180087750-180087772 CCTTGTTTGAAAAAGGAATAAGG + Intronic
918705868 1:187661245-187661267 CATTTCTTACAGAAGGAATGTGG + Intergenic
919719080 1:200812417-200812439 CCTAATTTGAAAATGGAATGAGG - Intronic
920019624 1:202945309-202945331 CCTTTCTTGCAGAAGTAAGGTGG - Intronic
920118795 1:203639927-203639949 CCCTATTTTCAGAGGCAATGTGG + Intronic
920970682 1:210741419-210741441 CCATATAAGCAGAAGGACTGAGG - Intronic
922074665 1:222231733-222231755 CCATATTTGTAGAATGAATGAGG - Intergenic
922929809 1:229380324-229380346 GCAAATTTGCAGAAGGAAAGAGG + Intergenic
923387189 1:233476863-233476885 ACTTATCTGCAGAAGTAATTGGG - Intergenic
923803333 1:237231825-237231847 CCTCCTTTGAAGAAGCAATGTGG - Intronic
923841601 1:237678309-237678331 AGTCATTTGAAGAAGGAATGCGG - Intronic
924672642 1:246145249-246145271 TCTTATTTGCAAAATGAAAGCGG + Intronic
924896450 1:248341774-248341796 TGTTATTTCTAGAAGGAATGGGG + Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1063528106 10:6803177-6803199 CAATATTTGCAGAAGGAGTCAGG + Intergenic
1064456425 10:15491462-15491484 GTTCATTTTCAGAAGGAATGAGG + Intergenic
1066422536 10:35276017-35276039 AGTTCTTTGCAGAAGGACTGGGG + Intronic
1068579685 10:58725018-58725040 CCCCATTTGCAGCAGGAATCTGG + Intronic
1068581563 10:58746425-58746447 CCTCTTTGGCAGAAGCAATGAGG - Intronic
1068614052 10:59092224-59092246 TCAAATTTGCAGAACGAATGAGG + Intergenic
1068651457 10:59527535-59527557 CATTATATGCAGAACCAATGTGG - Intergenic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1069183507 10:65393070-65393092 CCGTATTGACAGAAGCAATGAGG + Intergenic
1070295375 10:75156480-75156502 ACTTAATTACAGAGGGAATGAGG + Intronic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073184149 10:101605489-101605511 TTTTATTCGAAGAAGGAATGTGG + Intronic
1077032273 11:473883-473905 CTTTATTTGCAGAGGTATTGTGG + Exonic
1078491433 11:11772814-11772836 CCTTCTTTTTAGAAGGCATGTGG - Intergenic
1079665738 11:23103343-23103365 ATTTATTTGCAGGAAGAATGAGG + Intergenic
1079719631 11:23793457-23793479 CCTTATGTGTAGAAGGAATGTGG + Intergenic
1081157276 11:39709666-39709688 ACTTATTTGCATATGGAATTAGG + Intergenic
1081506202 11:43719582-43719604 CCTTTATTGCACAAGGAGTGAGG - Intronic
1082948484 11:58786562-58786584 CTTTAATTCAAGAAGGAATGTGG + Intergenic
1085841711 11:80018839-80018861 CCTTATTTGCAGATGCAATTAGG - Intergenic
1087335299 11:96836582-96836604 CATTATTGGTAGAAGAAATGCGG - Intergenic
1087405735 11:97727873-97727895 CCATTTTTGCAGAAGTAAGGGGG - Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1089308734 11:117543986-117544008 CCTTCCTTGCAGAGGAAATGGGG - Intronic
1089391366 11:118104255-118104277 CCTTACTTGGAGAAGGACTTAGG + Intronic
1089902335 11:122000408-122000430 CATTTTTTGCAGGAGTAATGTGG - Intergenic
1092674357 12:10900052-10900074 CTTTATTTCAAGAAGGAAAGTGG + Intronic
1092705547 12:11280409-11280431 CCTCATTTCAGGAAGGAATGAGG - Intergenic
1092709794 12:11323879-11323901 CCTCATTTCAAGAAGGAATGAGG - Intergenic
1092717261 12:11403573-11403595 CCTCATTTCAAGAAGGAATGAGG - Intronic
1092718117 12:11412921-11412943 CCTCATTTCAAGAAGGAATGAGG - Intronic
1093662890 12:21776926-21776948 CATTAATTAGAGAAGGAATGAGG + Intergenic
1095987655 12:48010381-48010403 CCTTTTTTCCAGTAGGAATTGGG + Intergenic
1096005998 12:48172394-48172416 ACTTATTTGGAAAAGAAATGGGG + Intronic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097786765 12:63768960-63768982 CCATCTTTTCAGAAGGGATGGGG + Intergenic
1097872734 12:64614635-64614657 CCTTATTTGCAAAGGGAATATGG - Intronic
1100019752 12:90055115-90055137 GCTTATTCACAGAAGGAATAAGG - Intergenic
1101013425 12:100474719-100474741 CCTTATTGACAGAGTGAATGGGG + Intronic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1104034048 12:125086387-125086409 CTTTGTTTGCAGCAGCAATGAGG + Exonic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1106424965 13:29618983-29619005 TCATATTTGCAGAAGTAAGGTGG - Intergenic
1107132267 13:36909755-36909777 CCTTTTGTGCAGAAGTACTGAGG + Intronic
1108444640 13:50495161-50495183 CTTTCTTTCCAGAAGAAATGAGG + Intronic
1111151796 13:84263135-84263157 TCTTCATTGCAGAAGGAATGTGG + Intergenic
1111383571 13:87493986-87494008 TCTTCTTTGAAGAGGGAATGTGG + Intergenic
1111638688 13:90939116-90939138 CCTTTATTGCAAAAGGATTGTGG - Intergenic
1118019637 14:61696654-61696676 CATTATTTGAAGAATGAATGAGG - Intronic
1118171579 14:63394537-63394559 CATTATTTGGAGAAGGAAAAGGG - Intronic
1118467913 14:66047874-66047896 CCTCATTTTAAGAAGGAGTGAGG - Intergenic
1119020466 14:71107083-71107105 CCTGGTGTGCAGAAGGAATCAGG + Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119242848 14:73076158-73076180 TCTTATTTTCAAAAGGAATGTGG - Intronic
1120575761 14:86179063-86179085 CCTTATTTGTAGAATGAGAGAGG + Intergenic
1121832277 14:97062770-97062792 CCTTATTCAGAGAAGGAATGTGG + Intergenic
1124205576 15:27716393-27716415 CCTTATTTGCAAATGACATGAGG - Intergenic
1124399792 15:29338223-29338245 CCTTATATGCAGAGGGGCTGTGG - Intronic
1124903305 15:33844727-33844749 CATTACTTGCTGAATGAATGAGG - Intronic
1125670236 15:41466803-41466825 CGTTATTTGCTGAAGGAACTGGG + Intronic
1127170440 15:56295160-56295182 CCTTATTAGCTGAAGGACTGGGG + Intronic
1127468148 15:59265213-59265235 CCTTAGTTGTAAAGGGAATGTGG + Intronic
1129525876 15:76213932-76213954 CTTTACTTGCAGAAGGCCTGAGG - Intronic
1130845699 15:87743162-87743184 CATTCTTTGCAGATGTAATGAGG - Intergenic
1131341931 15:91610675-91610697 TCTGAGTTGCAGGAGGAATGAGG + Intergenic
1131445501 15:92495324-92495346 GCTTGTTTGCAGAATGGATGTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133620814 16:7524619-7524641 CCCTGATTGGAGAAGGAATGTGG + Intronic
1133681556 16:8124792-8124814 CCTTCTTTGCAGAATATATGTGG - Intergenic
1134319147 16:13147058-13147080 TCTTATTTGCAGAAAGAATAAGG - Intronic
1136287123 16:29251030-29251052 CCCTGTTTGCTGAAGGAATGTGG + Intergenic
1137285925 16:47015770-47015792 CCTTATTTGTATACAGAATGGGG - Intergenic
1138247483 16:55478628-55478650 ACACATTTGCAGAAGGAAAGAGG + Intronic
1138528290 16:57621136-57621158 CCTAATTAACAGAGGGAATGTGG - Intronic
1139134053 16:64179871-64179893 CCTTTCTTGCAGGAGGAAGGTGG - Intergenic
1141550672 16:84804670-84804692 CCTTATTTGGAAAAAGAATCTGG + Intergenic
1142092728 16:88223662-88223684 CCCTGTTTGCTGAAGGAATGTGG + Intergenic
1142478428 17:203701-203723 CCTTATTAGCATAAGGAATGTGG + Intergenic
1144406911 17:14960748-14960770 TCTGATGGGCAGAAGGAATGAGG - Intergenic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1148687307 17:49508078-49508100 CCTGCCTTGGAGAAGGAATGAGG + Intronic
1150943756 17:69722289-69722311 CCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1154146631 18:11872104-11872126 CATTCTTTACAGATGGAATGAGG + Intronic
1155652131 18:28155110-28155132 CCTTATTTCCACAAGGAATCAGG - Intronic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1156024024 18:32631247-32631269 CCAGATTTTGAGAAGGAATGGGG - Intergenic
1157109056 18:44802498-44802520 CCTTTCTTGAAGAATGAATGGGG - Intronic
1157965423 18:52203303-52203325 CCATCTTTGGAGAAGGGATGAGG + Intergenic
1158607829 18:58911547-58911569 TCTTATTTGCTGTAGAAATGGGG - Intronic
1158898897 18:61942624-61942646 AATTAATTGCAGAAAGAATGTGG + Intergenic
1159550587 18:69892009-69892031 CCAAATATGCAGGAGGAATGGGG - Intronic
1159619552 18:70621558-70621580 CCTTATTTGCAGCAGAAAATAGG - Intergenic
1163808344 19:19414361-19414383 GTTGACTTGCAGAAGGAATGAGG + Intronic
1165638331 19:37362861-37362883 CCTTATGTGTGCAAGGAATGTGG + Exonic
1166243955 19:41512622-41512644 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244715 19:41517209-41517231 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1167026822 19:46925778-46925800 CCTCTTTTGCAGAAAGAATGTGG - Intronic
925629177 2:5871410-5871432 CCCCATCTGCAGTAGGAATGCGG - Intergenic
927194373 2:20537615-20537637 CATTATTTGCAGGAGTAATTAGG + Intergenic
928029628 2:27767486-27767508 CCTTTTTTGAAGAAGAAAGGAGG - Intergenic
929304725 2:40348025-40348047 CTTTATTTACTGAAGGAAGGAGG + Intronic
929524708 2:42691047-42691069 TCTTATTTTCAGTAGAAATGGGG + Intronic
929614094 2:43294753-43294775 CCTTAAGTTCAGAAGGAATCAGG + Intronic
929815829 2:45230645-45230667 CGTGATTTGAAGAAGAAATGAGG + Intergenic
930959086 2:57237216-57237238 CCTGGGTTGAAGAAGGAATGAGG - Intergenic
931014200 2:57956700-57956722 CCTTATTTGGAGAAGAAAGTAGG + Intronic
933674575 2:85042973-85042995 CCTTATTTCCTGAAGAAATGGGG - Intronic
936398817 2:112150468-112150490 CCTAAATTGCAGGAGGACTGAGG - Intronic
936506466 2:113111832-113111854 CCTTACTTGCAGAGGCAAAGAGG + Intronic
938377918 2:130820600-130820622 CCTTAGCAGGAGAAGGAATGTGG + Intergenic
938946999 2:136222014-136222036 CCTGAGTTGCAGAATGGATGTGG - Intergenic
939723443 2:145683814-145683836 TCTTATTTGAAGAAGTAATATGG - Intergenic
941490361 2:166136293-166136315 GCTTAGTTGCAGAAAGAATAAGG - Intergenic
942639086 2:178041558-178041580 CCTTATTTGCAGAAGTCACGTGG - Intronic
943695679 2:190927692-190927714 CCTTAAAAGCAGAAGGGATGAGG - Intronic
943819068 2:192295702-192295724 TCATATCTGCAGAAGGAATAGGG + Intergenic
946485596 2:220098027-220098049 CCATGTTTGCAGAAGGAACTGGG + Intergenic
947142207 2:227029999-227030021 GCTTATTTGCAAAAGGAATTAGG + Intronic
948779305 2:240308187-240308209 GCTAATTTGCAGAAGGACTCTGG + Intergenic
1169246701 20:4031584-4031606 CATTATTTGCAGAAGATATGAGG - Intergenic
1169566646 20:6861175-6861197 CCTTACTTACAAAACGAATGAGG + Intergenic
1170425216 20:16228711-16228733 ACTTACCTGCAGCAGGAATGAGG - Intergenic
1170649405 20:18226351-18226373 GCTTATGTGTAGAAGGAATGAGG + Intergenic
1170686013 20:18570186-18570208 CCACACTTGCTGAAGGAATGAGG - Intronic
1172484585 20:35290799-35290821 CCTGATTGGCATCAGGAATGGGG - Intronic
1173410119 20:42802661-42802683 CCTTTTTTGAAGTAAGAATGAGG + Intronic
1174262896 20:49309935-49309957 CCTGACTTGCAGAAGAGATGAGG + Intergenic
1175322235 20:58097216-58097238 CCTTGTTTGGTGAAGGACTGTGG - Intergenic
1177952855 21:27560535-27560557 CTTTATATGAAGAAGGAATTTGG + Intergenic
1178183104 21:30187003-30187025 CATTGTTTGCAGAATGAAGGCGG + Intergenic
1178459925 21:32793696-32793718 AATAATTTGCAGAAGGAATCTGG - Exonic
1183321954 22:37170293-37170315 CCTGTTTTGCAGAAGAGATGGGG + Intronic
1183869172 22:40728297-40728319 CCTTTTTTTCAGAAGGACAGAGG - Intergenic
1184686515 22:46098811-46098833 CCTCAGTTGCAGAAAGAAAGAGG - Intronic
949296131 3:2525935-2525957 CTTTATTTGTAGTAGCAATGGGG - Intronic
955715250 3:61822845-61822867 CCTTTTTTGGGGAAGGTATGAGG - Intronic
957378508 3:79392234-79392256 CCTTATTTGGTGAAGCAATGAGG - Intronic
958163894 3:89854102-89854124 CCTTTTTTGGAGAAGGAGTAGGG + Intergenic
959472492 3:106769335-106769357 ACCTATTTCCAGAAGCAATGTGG + Intergenic
962437007 3:135376012-135376034 CCTATTTGGTAGAAGGAATGAGG - Intergenic
963617383 3:147559106-147559128 CGTTTTTTGCAGTAGGGATGAGG + Intergenic
963861175 3:150312137-150312159 CCTTGTTTGTACAGGGAATGTGG + Intergenic
964212125 3:154240006-154240028 CTCTATTTGCAGAATGAAGGAGG - Intronic
966111475 3:176407740-176407762 CAGTGTTTGCTGAAGGAATGAGG - Intergenic
969034283 4:4240320-4240342 CCTTTATTGCAGCAGGAATTTGG - Exonic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
971004963 4:22362880-22362902 CCATATTTGGAGAAGGAGAGGGG - Intronic
972411861 4:38802977-38802999 CCATCTTTGCAGATGGACTGAGG + Intronic
972415127 4:38832216-38832238 CCTTCTTTGCAGAGGGGGTGAGG - Intronic
975725830 4:77290914-77290936 ACTTTTTTGCAGAGGGGATGGGG + Intronic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
978453174 4:108859349-108859371 CCTTCCTTGCAGAGGGAATGTGG - Intronic
981643317 4:146969603-146969625 TCTTCTTTGCAGGAAGAATGGGG - Intergenic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
984813474 4:183816873-183816895 ACTTCTTTGCAGAGGAAATGGGG + Intergenic
985733106 5:1561908-1561930 CTTTCTTTTCACAAGGAATGTGG + Intergenic
986902736 5:12457144-12457166 CCATAAATGCATAAGGAATGAGG + Intergenic
988579588 5:32457455-32457477 CATTATTTACATAAGGAATCAGG + Intergenic
989736884 5:44718285-44718307 ACTTACTAGCAGAATGAATGTGG - Intergenic
990005884 5:50944072-50944094 CCATTTTTGCAGAAGTAAAGTGG - Intergenic
990086969 5:51990590-51990612 ACTTATTTGCAGAAGACATTTGG - Intergenic
990241402 5:53819886-53819908 TCCTATTTGCAGTAGAAATGTGG + Intergenic
990411753 5:55548119-55548141 CCTTGTTTGGAGTAGGAGTGAGG + Intergenic
990484213 5:56242349-56242371 CCAAATTTGCAGAAGTAATGAGG + Intergenic
990833456 5:59986775-59986797 CCAGATTTCCAGAAGGAAAGTGG - Intronic
991252840 5:64582905-64582927 CCTTATTTCCTAATGGAATGAGG + Intronic
991415775 5:66391503-66391525 CCATTCTTGCAGAAGGAAGGTGG - Intergenic
993024103 5:82626464-82626486 AGATATTTGCAGAAGTAATGAGG + Intergenic
994323796 5:98425435-98425457 CCTTAGTTGCTGAAGGTCTGTGG + Intergenic
994417099 5:99485847-99485869 CCTATTTTTGAGAAGGAATGTGG + Intergenic
994462876 5:100089321-100089343 CCTATTTTTGAGAAGGAATGTGG - Intergenic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
996032396 5:118720662-118720684 CCATTTTTGCAGAAGTAATGTGG - Intergenic
997532788 5:134592522-134592544 CCTTTTTTGCAAAAGGGGTGAGG - Intergenic
998354704 5:141525282-141525304 CTTCATTTGCAGAAGGTTTGTGG + Intronic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1003297685 6:4847363-4847385 CCTTAGCTGCTGAAAGAATGTGG - Intronic
1003952909 6:11134241-11134263 CATTTTTTGTACAAGGAATGAGG - Intronic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1006125761 6:31836869-31836891 CCTATTTTGCAGTAGAAATGAGG - Intronic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1009364476 6:62847409-62847431 CCTGATATCCAGAAGGAAAGAGG - Intergenic
1009903248 6:69835742-69835764 GCTTATTTTCTGAGGGAATGGGG + Intergenic
1010011007 6:71048160-71048182 CCTTATTTGCAAAACAAAGGTGG + Intergenic
1013111379 6:107067867-107067889 CCATGTATGGAGAAGGAATGGGG + Exonic
1016606350 6:145933131-145933153 ACATCTTTGCAGAAGAAATGTGG - Exonic
1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG + Intergenic
1016888661 6:148983815-148983837 CCTTTTCTGGACAAGGAATGAGG - Intronic
1017847229 6:158269594-158269616 CCTGATTTCCAGATGGAATCAGG + Intronic
1018150424 6:160932117-160932139 CCTTATTTAAAGAAGCAATAGGG + Intergenic
1018390009 6:163335094-163335116 CCTTATAGAAAGAAGGAATGTGG + Intergenic
1020474312 7:8577855-8577877 GCTTATTTGAAGAGGGACTGAGG + Intronic
1021383478 7:19998346-19998368 CCATGTTTCCAGAAAGAATGTGG - Intergenic
1021972819 7:25982171-25982193 CTTTACTTGGTGAAGGAATGGGG - Intergenic
1022526961 7:31044382-31044404 CCTTATTGGAAGAAGGAACCTGG - Intergenic
1023126857 7:36962744-36962766 TCCTTTTTGCAGAAGGAAGGAGG - Intronic
1028610089 7:92700976-92700998 CCTTAGTTACAGAAGAAAAGAGG + Intronic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1030686904 7:112496439-112496461 TTTTATTTGCAGAAAGAAGGGGG + Intergenic
1031689636 7:124771790-124771812 CCTTATTTCTGAAAGGAATGGGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1032646818 7:133834098-133834120 CCTTATTTGAAGCAGAATTGTGG + Intronic
1033260145 7:139837110-139837132 CCATTCTTGCAGAAGTAATGTGG - Intronic
1033268251 7:139906010-139906032 CATTTTTTGCATAAGGTATGAGG + Intronic
1034074327 7:148217297-148217319 CATTTTTTGAAGAAGGGATGTGG + Exonic
1035582054 8:746595-746617 CCTCATCTGCTGAATGAATGTGG + Intergenic
1036045832 8:5139288-5139310 TATTATCTACAGAAGGAATGTGG - Intergenic
1037057254 8:14457661-14457683 CCTGATATGCAGAAATAATGGGG + Intronic
1037461702 8:19117198-19117220 CCATAGGGGCAGAAGGAATGAGG - Intergenic
1038364447 8:26916790-26916812 CCTAAAATGCTGAAGGAATGGGG - Intergenic
1039307975 8:36284516-36284538 CCTTTTTTGCAGATGATATGAGG - Intergenic
1040603240 8:48904864-48904886 CCTTATTTGCAGAACCAGTAAGG + Intergenic
1041702628 8:60808205-60808227 CTTTTGTTGCAGAAGGAATCTGG + Exonic
1042702592 8:71632649-71632671 CTTTATTTGAAGAGGGTATGAGG - Intergenic
1044473896 8:92604282-92604304 CATAATTTGCTGAAGGATTGGGG - Intergenic
1044937133 8:97303962-97303984 CCTCATTTGCAGTAGGCTTGGGG + Intergenic
1045925749 8:107577616-107577638 CCTAATATTCAGAAGGAAAGAGG + Intergenic
1045926611 8:107583552-107583574 TTTAATTTGCAGAAGGAAAGAGG - Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1047975856 8:130129849-130129871 ATTCATATGCAGAAGGAATGGGG + Intronic
1055431156 9:76245613-76245635 CTAATTTTGCAGAAGGAATGAGG + Intronic
1055794014 9:79955001-79955023 ACATATTTGCATAAGTAATGAGG + Intergenic
1056018231 9:82414946-82414968 CATTATTTGCAGGAGTAAGGTGG - Intergenic
1056512228 9:87316808-87316830 CCTTTTGTTCAGAAGAAATGTGG - Intergenic
1058631083 9:106987354-106987376 CCATTTTTGCAGAAGTAAGGTGG + Intronic
1059537636 9:115097428-115097450 CCTTGTATCCAGAAGGGATGGGG + Intronic
1060760298 9:126241547-126241569 CTTAATTTGCATAAGTAATGTGG + Intergenic
1062128060 9:134876313-134876335 TCTGATTTTCAGAAGGAATGTGG + Intergenic
1186270281 X:7879252-7879274 CCCTATTTGCAGAAGATACGAGG - Intergenic
1188347125 X:29080537-29080559 CCTTATCTGAAGCAGGAAAGAGG + Intronic
1188507694 X:30900369-30900391 CTTGACTTGCAGAAGGCATGGGG + Intronic
1189784030 X:44543172-44543194 CCTTAAGGGCTGAAGGAATGGGG + Intergenic
1193321389 X:80125948-80125970 CCATTTTTGCAGCAGTAATGTGG + Intergenic
1194645743 X:96456284-96456306 ACTGATTACCAGAAGGAATGTGG - Intergenic
1194676870 X:96804948-96804970 CCTTAATCTCATAAGGAATGAGG + Intronic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic
1201256162 Y:12110280-12110302 CAGGGTTTGCAGAAGGAATGAGG - Intergenic
1202035975 Y:20635928-20635950 CCATTCTTGCAGAAGGAAGGTGG + Intergenic