ID: 969829449

View in Genome Browser
Species Human (GRCh38)
Location 4:9782781-9782803
Sequence TCGCCCAGGTGCAGATCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 5, 1: 1, 2: 0, 3: 2, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969829446_969829449 -2 Left 969829446 4:9782760-9782782 CCTACACGCGCATCTACCGCATC 0: 4
1: 2
2: 0
3: 1
4: 27
Right 969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG 0: 5
1: 1
2: 0
3: 2
4: 63
969829444_969829449 19 Left 969829444 4:9782739-9782761 CCGTTGCCATCATGATCGTGACC 0: 1
1: 5
2: 0
3: 12
4: 111
Right 969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG 0: 5
1: 1
2: 0
3: 2
4: 63
969829443_969829449 20 Left 969829443 4:9782738-9782760 CCCGTTGCCATCATGATCGTGAC 0: 1
1: 0
2: 5
3: 7
4: 59
Right 969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG 0: 5
1: 1
2: 0
3: 2
4: 63
969829445_969829449 13 Left 969829445 4:9782745-9782767 CCATCATGATCGTGACCTACACG 0: 6
1: 0
2: 0
3: 2
4: 24
Right 969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG 0: 5
1: 1
2: 0
3: 2
4: 63
969829442_969829449 21 Left 969829442 4:9782737-9782759 CCCCGTTGCCATCATGATCGTGA 0: 1
1: 0
2: 5
3: 2
4: 75
Right 969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG 0: 5
1: 1
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969829449 Original CRISPR TCGCCCAGGTGCAGATCCGC AGG Exonic