ID: 969830431

View in Genome Browser
Species Human (GRCh38)
Location 4:9791781-9791803
Sequence TACTCCTTGATTGCAGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 3, 1: 3, 2: 4, 3: 27, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969830427_969830431 15 Left 969830427 4:9791743-9791765 CCTCAGTTGAGCCTTCAGATGAG 0: 15
1: 76
2: 220
3: 485
4: 840
Right 969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG 0: 3
1: 3
2: 4
3: 27
4: 149
969830429_969830431 -9 Left 969830429 4:9791767-9791789 CCATAGCCTTATATTACTCCTTG 0: 6
1: 0
2: 0
3: 7
4: 126
Right 969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG 0: 3
1: 3
2: 4
3: 27
4: 149
969830426_969830431 16 Left 969830426 4:9791742-9791764 CCCTCAGTTGAGCCTTCAGATGA 0: 7
1: 18
2: 28
3: 73
4: 265
Right 969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG 0: 3
1: 3
2: 4
3: 27
4: 149
969830428_969830431 4 Left 969830428 4:9791754-9791776 CCTTCAGATGAGACCATAGCCTT 0: 6
1: 4
2: 25
3: 117
4: 275
Right 969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG 0: 3
1: 3
2: 4
3: 27
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969830431 Original CRISPR TACTCCTTGATTGCAGCCTT TGG Intronic
904434170 1:30483450-30483472 TGCTCCATGACTGCAGGCTTAGG - Intergenic
909365486 1:74815682-74815704 TACTCTTTGATTGTAGCATTTGG - Intergenic
909627358 1:77732687-77732709 TGCTCCTTGTAAGCAGCCTTGGG - Intronic
910445428 1:87294838-87294860 TCCCCCTTGATTTCAGCCCTGGG - Intergenic
912549304 1:110474345-110474367 TACTCCCTGATTTCAGCCACTGG + Intergenic
913974130 1:143440667-143440689 TACTCCTTGATTGCGGCCTTTGG - Intergenic
914068519 1:144266281-144266303 TACTCCTTGATTGCGGCCTTTGG - Intergenic
914110636 1:144700073-144700095 TACTCCTTGATTGCGGCCTTTGG + Intergenic
918776620 1:188639946-188639968 TACTTCTTGATTTCAAACTTAGG + Intergenic
919351080 1:196454858-196454880 AACACCTTGATTTCTGCCTTGGG - Intronic
919917410 1:202147267-202147289 TGCTCCTTCCTTACAGCCTTGGG - Exonic
921906466 1:220500611-220500633 GACACTTTGATTGCAGTCTTAGG + Intergenic
1063011962 10:2031202-2031224 TCCTACTTGATAACAGCCTTTGG + Intergenic
1064851242 10:19711174-19711196 TTCTCCTTAAATGCATCCTTAGG + Intronic
1065201180 10:23314590-23314612 ACCACCTTAATTGCAGCCTTGGG - Intronic
1065849787 10:29778185-29778207 TACTCTGTGATGGCAGCCCTGGG + Intergenic
1066305596 10:34137418-34137440 GACTCCTTGATTGCACCCCGAGG + Intronic
1068566847 10:58585544-58585566 TTTTCCGTGATTGCAGTCTTCGG + Intronic
1075815043 10:125258589-125258611 TACTCCTTGACTGTAGGTTTGGG + Intergenic
1077814426 11:5671934-5671956 TTTGCCTTGATTGTAGCCTTTGG - Intronic
1077869234 11:6247788-6247810 GACACCTTGATTTCAGCATTTGG - Intergenic
1079682297 11:23313114-23313136 GACACCTTGATTACAGCATTAGG - Intergenic
1080863115 11:36167702-36167724 GACAGCTTGATTGCAGACTTTGG + Intronic
1081560876 11:44215251-44215273 TACTCTTCAATTGCTGCCTTAGG + Intronic
1083058668 11:59847307-59847329 GACATCTTGATTGCAGCCCTGGG + Intergenic
1084839971 11:71838521-71838543 TAATTTTTGATAGCAGCCTTAGG - Intergenic
1086676183 11:89609823-89609845 GACACTTTGATTTCAGCCTTAGG - Intergenic
1089783200 11:120889059-120889081 TGCTACTAGAATGCAGCCTTTGG + Intronic
1090424841 11:126600304-126600326 TACATCTTGATTGCAGCCTTGGG + Intronic
1095178831 12:39123642-39123664 GATACCTTGATTGCAGCCTCTGG - Intergenic
1098295667 12:69001581-69001603 GACACCTTGCTTGCAGTCTTGGG + Intergenic
1100790504 12:98125028-98125050 AACATCTTGATTTCAGCCTTGGG + Intergenic
1100865442 12:98852426-98852448 TTCTACTTGATTGCAGAATTTGG - Intronic
1101062137 12:100983444-100983466 AACACCTTGATTGCAGCCTTGGG - Intronic
1101517966 12:105454532-105454554 GACACCTTGATTACAGACTTAGG - Intergenic
1102546252 12:113658440-113658462 TTCTTCTTGTATGCAGCCTTTGG + Intergenic
1102617513 12:114167421-114167443 AACACCTTGATTTCAGCCTTGGG + Intergenic
1104382087 12:128315955-128315977 GACACCGTGATTTCAGCCTTTGG + Intronic
1105321912 13:19333449-19333471 CACTCTTTGATTTCAACCTTAGG + Intergenic
1106333730 13:28763964-28763986 AATACCTTGATTGCAGCCTGTGG - Intergenic
1107539607 13:41375427-41375449 CACTGCTTGATGGCAGCTTTGGG + Exonic
1113695971 13:112345704-112345726 TGCCCCTCGACTGCAGCCTTGGG - Intergenic
1116381002 14:44267823-44267845 GACACTTTGATTGCAACCTTGGG + Intergenic
1117197428 14:53354409-53354431 TATTCCCTGACTTCAGCCTTAGG + Intergenic
1119128474 14:72150343-72150365 AACACCTTGATTCCAGACTTCGG + Intronic
1119989320 14:79177568-79177590 AAACCCTAGATTGCAGCCTTGGG - Intronic
1120010392 14:79406699-79406721 TTCTCCTTAATTGCAACTTTAGG - Intronic
1124095048 15:26641574-26641596 CTGTCCTTGATTGAAGCCTTTGG + Intronic
1128608837 15:69058123-69058145 AACCCCATGATGGCAGCCTTGGG - Intronic
1130877297 15:88025677-88025699 AACACCTTGATTTCAGACTTTGG + Intronic
1131114143 15:89783931-89783953 GACTCCATGATTCCAGCCTGCGG + Intergenic
1131466262 15:92656838-92656860 GACACCTTGATTGCACCTTTGGG - Intronic
1135965281 16:27030187-27030209 GACACCTTGATTGCAGCTTCAGG + Intergenic
1136002670 16:27306806-27306828 GACTCCTTGCTTCCACCCTTGGG - Intergenic
1137445343 16:48528184-48528206 GACACCCTGATTGCAGCCTGGGG - Intergenic
1138261467 16:55626361-55626383 GACACCTTGATTTCAGACTTAGG + Intergenic
1143890838 17:10101205-10101227 GACATCTTGATTGTAGCCTTGGG - Intronic
1144067605 17:11638752-11638774 AACACCTTGATTTCAGCTTTGGG - Intronic
1144117184 17:12108327-12108349 TACTCCATAATTGAAGCCCTTGG + Intronic
1147720810 17:42538198-42538220 GGCTCCTTGATGGCAGCGTTCGG + Intronic
1149550644 17:57537043-57537065 TGGTCATTCATTGCAGCCTTTGG + Intronic
1152312681 17:79560433-79560455 TTCTCCTTGACTGTAGCCTCAGG + Intergenic
1154462279 18:14604570-14604592 TTCTCCCTAAATGCAGCCTTTGG - Intergenic
1157257511 18:46152188-46152210 GACACCTTGATTTCAGCCTGGGG + Intergenic
1158475837 18:57778582-57778604 CACACCTTGACTGCAGCCTTGGG - Intronic
1160287610 18:77559542-77559564 GACACCTTGATTTCAGACTTTGG - Intergenic
1166438393 19:42789122-42789144 TCCTCCTTTTTGGCAGCCTTGGG + Intronic
925613119 2:5719997-5720019 TGCTCCTGGCTTGCAGCCTTTGG - Intergenic
934178834 2:89601631-89601653 TACTCCTTGATTGCAGCCTTTGG - Intergenic
934289121 2:91675917-91675939 TACTCCTTGATTGCAGCCTTTGG - Intergenic
936554477 2:113482522-113482544 TACTCCTTAAAAGCAGCCTGGGG + Intronic
937219384 2:120333061-120333083 TACTCCATGCTCGCAGCATTTGG + Intergenic
938187941 2:129249825-129249847 GACACCTTGATTTCAGCCCTGGG - Intergenic
939585021 2:143993663-143993685 AACACCTTGATTTCAGCCTGGGG + Intronic
939702681 2:145413263-145413285 GACACTTTGTTTGCAGCCTTGGG - Intergenic
941725062 2:168851867-168851889 GATACCTTGATTGCAGCCTTGGG - Intronic
941778684 2:169420841-169420863 TAGTCATTGATTTCAGCCATTGG + Intergenic
945722770 2:213439080-213439102 AACACCTTGATTTCAGCCTGGGG + Intronic
1169693732 20:8363280-8363302 GACATCTTGATTTCAGCCTTAGG - Intronic
1172902167 20:38343379-38343401 TCCTCCTTGATTCCTCCCTTCGG + Intergenic
1173033149 20:39380747-39380769 GACTACTTGATAGCAGCCTCAGG + Intergenic
1173148365 20:40544806-40544828 AACATCCTGATTGCAGCCTTAGG + Intergenic
1173355045 20:42279483-42279505 GACACCTTGATTTCAGACTTTGG + Intronic
1174039604 20:47689514-47689536 GACACCTTGATTGCAACCTCAGG + Intronic
1174150432 20:48482558-48482580 AACTCCTTGATTGCATCCCTTGG - Intergenic
1174971320 20:55278927-55278949 GACTCCTTGATTTCAGCCTGTGG + Intergenic
1175002235 20:55641841-55641863 GACACCTTGATGGCAGCCTTGGG + Intergenic
1176812281 21:13554115-13554137 TTCTCCCTAAATGCAGCCTTTGG + Intergenic
1178482245 21:32989716-32989738 TACTTCATTATTGCAGCCATAGG - Intergenic
1178880644 21:36447456-36447478 TCCTTCCTGACTGCAGCCTTGGG + Intergenic
1179050611 21:37885759-37885781 AACACCTTGATTTCAGCCTTGGG + Intronic
1179599730 21:42468857-42468879 TCCTCCTTCATTACAGCCTAAGG - Intergenic
1180942444 22:19668155-19668177 GACACCTTGACTGCAGCCTCGGG - Intergenic
1181155791 22:20919061-20919083 AACTCCAGGACTGCAGCCTTTGG + Intronic
1182911013 22:33984676-33984698 TTCCCCTAGATTGCAGCCTTTGG + Intergenic
1183127691 22:35800472-35800494 TTCTACTTGATTGAAGCTTTAGG - Intronic
1184665388 22:45986319-45986341 GATGCCTTGATTGCAGCCTTGGG + Intergenic
950177056 3:10882199-10882221 TACTCCTTCTTTGGAGCCTTGGG + Intronic
951633428 3:24746092-24746114 TACTTCTTGATTGAGGCTTTAGG + Intergenic
951819954 3:26797180-26797202 TACTACTGGACTGCAGACTTTGG + Intergenic
955084607 3:55690594-55690616 TACACCTTGTTTGCAGTATTAGG - Intronic
958594900 3:96210058-96210080 TACTCCTTGGTTGTAGCCATTGG + Intergenic
960166397 3:114407222-114407244 TACTGCTTGAATGCAGGGTTTGG + Intronic
962902484 3:139773480-139773502 GATACCTTGATTGCAGTCTTGGG + Intergenic
969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG + Intronic
970558591 4:17260333-17260355 GACCCCTTGATTACAGTCTTGGG - Intergenic
972015725 4:34242430-34242452 TACATCTTGATTGCAGCCTTAGG + Intergenic
974234312 4:59161063-59161085 CACTCCTTGCGTGCAGCCCTGGG - Intergenic
974484278 4:62487244-62487266 AACACCTTGACTGCAGCCTTGGG - Intergenic
977535212 4:98249500-98249522 TACTACTTTATTTCTGCCTTAGG + Intergenic
977797949 4:101191405-101191427 TACTCCTTAATTTCAGCCCTTGG - Intronic
983746177 4:171203141-171203163 TCCTCCTCGATTGCAGTCATTGG + Intergenic
984827437 4:183939239-183939261 AACACGTTGATTTCAGCCTTCGG - Intronic
986252110 5:6069601-6069623 GACTCCTTGATCTCAGACTTTGG + Intergenic
986281888 5:6330258-6330280 GGCTTCTTGATTGCACCCTTTGG - Intergenic
986788699 5:11139815-11139837 AACACCTTGATTTCAGCCTGTGG - Intronic
987391707 5:17382287-17382309 CACACCTTGATTGCAGCCTGCGG + Intergenic
988146683 5:27318218-27318240 AACACCTTGATTTCAGGCTTTGG - Intergenic
988483304 5:31647434-31647456 AACACCTTGATTTCAGACTTCGG - Intronic
992895578 5:81242349-81242371 TACTCTTTGATGACATCCTTGGG + Intronic
996939220 5:128983744-128983766 TACTTCATTATAGCAGCCTTAGG - Intronic
998566533 5:143220775-143220797 TACACCTTGAGTGCCTCCTTAGG - Intronic
998626292 5:143850114-143850136 GAGACCTTCATTGCAGCCTTAGG - Intergenic
1003399710 6:5781777-5781799 GACACCTTGATTTCAGACTTCGG + Intergenic
1003467370 6:6393527-6393549 TACTCCTTTATTACAAGCTTGGG + Intergenic
1003610214 6:7606853-7606875 GACTCCTTGATTTCTGGCTTAGG - Intronic
1004323136 6:14648664-14648686 AACACCTTGATTTCAGACTTTGG - Intergenic
1004761977 6:18677353-18677375 TAGCTCTTGACTGCAGCCTTGGG - Intergenic
1005361889 6:25038696-25038718 AACACCTTCATTGCAGCCTTGGG + Intronic
1005747941 6:28856785-28856807 TACTCCTAGAAAGCAGCCTCAGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007132815 6:39492497-39492519 GAGTCCTTGGTTGCAGTCTTTGG - Intronic
1009897489 6:69771184-69771206 AACATCTTGATTGCAGCCTTGGG - Intronic
1010331720 6:74630596-74630618 TACTCATTGATTTCATCCTTGGG - Intergenic
1010866135 6:80978625-80978647 TACTCCATGTTTTCAGCCTTTGG + Intergenic
1012825678 6:104143955-104143977 AACACCTTGATTTCAACCTTGGG - Intergenic
1012915796 6:105168987-105169009 GACACCTTGACTGCAGGCTTGGG + Intronic
1014859916 6:126453267-126453289 TTTTCCTTCATTTCAGCCTTGGG - Intergenic
1016210529 6:141527913-141527935 AACAAATTGATTGCAGCCTTGGG - Intergenic
1018532173 6:164777604-164777626 TACTCCTTTTTTGCATCCTCTGG + Intergenic
1024503033 7:50133634-50133656 GACACCTTGATTCCAGCTTTAGG - Intronic
1024961415 7:54980827-54980849 TCCTTCCTGCTTGCAGCCTTTGG - Intergenic
1027851337 7:83455931-83455953 AACACCTTGATTTCAGCCTTGGG + Intronic
1028172821 7:87619003-87619025 GAAACCTTGATTTCAGCCTTAGG + Intronic
1029670212 7:102024960-102024982 GACACCTTGATTCCAGCCTGGGG - Intronic
1030427724 7:109400666-109400688 CACACCTTGATTGCAGGTTTGGG + Intergenic
1032727076 7:134600218-134600240 AACACCTTGATTGCAGCCTTGGG - Intergenic
1032914678 7:136476714-136476736 CACTTTTTGATTGCAACCTTAGG - Intergenic
1034563115 7:151894349-151894371 CACACCTTGACTGCAGACTTCGG + Intergenic
1034847043 7:154456033-154456055 AACTCCTGAATTGCTGCCTTTGG - Intronic
1037152930 8:15660143-15660165 TCATCCTTGATTGCATCCTTAGG - Intronic
1038435284 8:27531626-27531648 CACTCCTGGATGGCATCCTTTGG + Intronic
1039492022 8:37955018-37955040 GACATCTTGATTGCAGCCTGGGG - Intergenic
1041149909 8:54920838-54920860 GACACCTTGATTGCAGACTAGGG - Intergenic
1041444440 8:57934719-57934741 GACTTCTTGATTTCAGCCTTAGG - Intergenic
1041647944 8:60272747-60272769 TCCTCCTTGAGGGCAGGCTTTGG + Intronic
1044478339 8:92655075-92655097 TAGTCCTTGAAAGCAGCATTGGG + Intergenic
1045496528 8:102714204-102714226 GACATCTTGATTTCAGCCTTAGG - Intergenic
1046265788 8:111828051-111828073 AACAACTTGATTACAGCCTTAGG - Intergenic
1046660381 8:116942246-116942268 TATTCCTTGAAAACAGCCTTCGG + Intronic
1047897001 8:129377433-129377455 AACACCTTGATTACAGCCTCAGG + Intergenic
1048325662 8:133437073-133437095 AACTCCCTGACTGGAGCCTTTGG + Intergenic
1048979168 8:139693984-139694006 GACACCTTGAATGCAGCCTGTGG + Intronic
1049153953 8:141055768-141055790 TACACCTTCGTTGCTGCCTTTGG + Intergenic
1049898532 9:134663-134685 TACTCCTTAAAAGCAGCCTGGGG - Intronic
1051008075 9:12373623-12373645 TTCTCCTTGATGGGAGCCTGAGG - Intergenic
1052376181 9:27720122-27720144 AACATCTTGATTGCAGCCTTGGG - Intergenic
1053741584 9:41144965-41144987 TACTCCTTAAAAGCAGCCTGGGG - Intronic
1054346798 9:63974446-63974468 TACTCCTTAAAAGCAGCCTGGGG - Intergenic
1054444576 9:65301109-65301131 TACTCCTTAAAAGCAGCCTGGGG - Intergenic
1054485695 9:65720386-65720408 TACTCCTTAAAAGCAGCCTGGGG + Intronic
1054686760 9:68286334-68286356 TACTCCTTAAAAGCAGCCTGGGG + Intronic
1055196513 9:73600828-73600850 AACACCTTGATTTCAGCCTTGGG - Intergenic
1056223017 9:84468414-84468436 GACACCTTGATTTCAGACTTTGG + Intergenic
1057289052 9:93788745-93788767 TAATCCTCGATTCCAGCCCTTGG - Intergenic
1057765415 9:97912969-97912991 CATTCCTTCCTTGCAGCCTTGGG - Intronic
1061305291 9:129729178-129729200 GACACCTCGATTGCAGCCCTGGG + Intergenic
1185824441 X:3236400-3236422 AACACCTTGATTTCAGCCTGGGG - Intergenic
1186963661 X:14764153-14764175 GACACCTTAATTGCAGCCTTGGG - Intergenic
1187068584 X:15865449-15865471 GACACCTTGATTTCAGCCTTGGG + Intergenic
1190905291 X:54721344-54721366 TATTCCTTGACTGGAACCTTGGG - Intergenic
1192052005 X:67732926-67732948 TTCTCCTTGCTTGAAGCCTGTGG - Intergenic
1194023819 X:88726444-88726466 CAGCCCTTGATAGCAGCCTTGGG - Intergenic
1195333139 X:103822746-103822768 TACTCACAGATTTCAGCCTTTGG + Exonic
1198812333 X:140548303-140548325 TAGTCTTTTATTGCAGCCTATGG + Intergenic
1199460201 X:148075638-148075660 TACTTTTTAATGGCAGCCTTAGG + Intergenic