ID: 969833980

View in Genome Browser
Species Human (GRCh38)
Location 4:9823910-9823932
Sequence TGCTTATGTTGGGGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969833975_969833980 30 Left 969833975 4:9823857-9823879 CCAACTGGATGAATAATAAGCAA 0: 1
1: 0
2: 1
3: 21
4: 231
Right 969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG 0: 1
1: 0
2: 2
3: 35
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969833980 Original CRISPR TGCTTATGTTGGGGGAGTGA AGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902806596 1:18865076-18865098 TGCATTTGTTGGGGGCGTGTTGG - Intronic
903736190 1:25531227-25531249 TGCTTGTGATCGAGGAGTGAAGG - Intergenic
904366229 1:30012538-30012560 TGCTTTAGTTGGGGTAGTCAGGG - Intergenic
904470400 1:30732294-30732316 TGGGTATGTGGGGGGAGTGTGGG + Intergenic
906279402 1:44543103-44543125 TGCTGAGGCTGGGGGAGGGAGGG - Intronic
906360816 1:45156694-45156716 TGCATATGTCGGGGTAGTGTGGG + Intronic
906539508 1:46574390-46574412 TCCTAAGATTGGGGGAGTGATGG + Intronic
909389382 1:75101072-75101094 TGCTTTTGTTGGGGGGTTGTCGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910996909 1:93115680-93115702 TGATTATGGTGTGTGAGTGATGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912584187 1:110746932-110746954 TGTTGTGGTTGGGGGAGTGATGG + Intergenic
912726939 1:112067136-112067158 TGGTGATGTTGGGGGAGTCGAGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915162454 1:153930066-153930088 TGCTGATGTTGGGGGAGATCTGG - Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915914346 1:159932030-159932052 TGTTTAGCTAGGGGGAGTGAGGG - Intronic
916118133 1:161505541-161505563 TGCTGCTGCTGGGTGAGTGAGGG + Exonic
918093363 1:181315985-181316007 TGTGTATGTTGGGGTAGTGGTGG + Intergenic
919054046 1:192546784-192546806 AACTTATGTTGGTGGAGTCATGG - Intergenic
920882800 1:209896067-209896089 TGCTTGGGTTGGGGGTGGGAAGG + Intergenic
922196136 1:223362709-223362731 TGTGTATGTTGGGGGCGTGGAGG - Intronic
922534602 1:226370596-226370618 TGCTCCTGTTGGGGGCCTGAGGG - Intronic
1065355015 10:24832197-24832219 TGTTTTTGTTGGGGTAGAGACGG - Intergenic
1067336608 10:45371413-45371435 TGTGTATGTTGGGGGGGTGCTGG - Intergenic
1068732591 10:60375745-60375767 TGTTTATGTTGGGGGAAGTAGGG - Intronic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1070265732 10:74900811-74900833 TGCAAATGTTGGGGGAGTGGGGG + Intronic
1070482831 10:76902049-76902071 TCCTTATGTGATGGGAGTGAGGG + Intronic
1072842978 10:98795717-98795739 TGATTAGGCTGGGGGAGTGGCGG - Intronic
1075303733 10:121348901-121348923 ATCTTTTCTTGGGGGAGTGAAGG + Intergenic
1075476369 10:122738267-122738289 TGTATATGTTGGGGGAGGAAAGG - Intergenic
1077834965 11:5918437-5918459 GGATTATGTTGGGTGAGAGAGGG - Intronic
1078054103 11:7993071-7993093 TGCTTGGGGTGGGGGAGGGATGG - Intronic
1080756264 11:35202444-35202466 TTCTTATGTTTGGGGAGTGAGGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081047824 11:38297785-38297807 TGCTCAAGTGGGGGGAGAGAAGG - Intergenic
1083725152 11:64624042-64624064 TGCTTATTTTGTGGGAGGGAGGG + Intronic
1084004981 11:66317832-66317854 TGGGGGTGTTGGGGGAGTGAGGG + Intergenic
1084065555 11:66701900-66701922 TGCTTGTTTTGGGGGAGTTGTGG - Intronic
1084528623 11:69713328-69713350 TGCTTATTTTAGGGGAGGGAAGG - Intergenic
1090499354 11:127246760-127246782 TGCTTTTGTTGGTGGAGGGAAGG + Intergenic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1091194618 11:133720295-133720317 TGCATCTGTTGGGGGAGAGAAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096094209 12:48924023-48924045 TGCTTTTGTCGGGGGAGTTGAGG - Intronic
1097059361 12:56271034-56271056 TTCTTTTCCTGGGGGAGTGAAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097395642 12:59070817-59070839 TGTTTATTTTGGCAGAGTGAAGG + Intergenic
1098329458 12:69337684-69337706 TACTAGAGTTGGGGGAGTGAGGG + Intergenic
1100186630 12:92146088-92146110 TGCTTGTGTCGAGGGAGGGAGGG + Intergenic
1101426883 12:104595433-104595455 TGCTCAGGTTTGGGGAGTCAAGG - Intronic
1101468441 12:104971914-104971936 TGCTTGAGTTGGGGAAGTGGAGG + Intergenic
1101590986 12:106125145-106125167 AGCTTAAGTTGTGGCAGTGATGG + Intronic
1102455230 12:113066777-113066799 TGCTTCTGTTCTGGGGGTGAGGG + Intronic
1106088669 13:26566555-26566577 AGCTTATGTTGGGGTCGTCATGG + Intronic
1107374337 13:39785894-39785916 TGCTCAGCTTTGGGGAGTGAAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1110293981 13:73840824-73840846 GGCTTAAGTAGGGGGAGGGAAGG - Intronic
1110514808 13:76397556-76397578 TGACAATGTTGGGGGAGTGGTGG - Intergenic
1110636920 13:77777054-77777076 TGTTTATATTGGGAAAGTGAAGG - Intergenic
1110657080 13:78012696-78012718 TGTGTGTGTTGGGGGGGTGAAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117846049 14:59912922-59912944 TGCTTATGCTGGGTGAGGGAAGG - Intergenic
1118434885 14:65761713-65761735 TGGATAAGCTGGGGGAGTGAAGG + Intergenic
1118832324 14:69446117-69446139 TGTTGATGTTGGTGGAGTCAGGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120177685 14:81312598-81312620 TCCTTAGGTTGGAGGTGTGATGG - Intronic
1120762579 14:88298844-88298866 TGGTGATGTTGGGGGCATGAAGG - Intronic
1122254515 14:100467117-100467139 TCCTTTTGTTGGAGGAGAGAAGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125148118 15:36496969-36496991 TTCTTATTTTGGGGGAGAGGTGG - Intergenic
1126282400 15:46970018-46970040 TGTGTGTGTTGGGGGAGGGAGGG - Intergenic
1126557190 15:50002421-50002443 TGCTTATGTTGTGATAGTCAAGG - Intronic
1126667534 15:51088935-51088957 TGCTTATTTTGGGGGTGTAAAGG + Intronic
1127872908 15:63088215-63088237 TGTGTGTGTTGGGGGGGTGATGG + Intergenic
1128020856 15:64389001-64389023 TGCTGAGGTTGGGGAAATGAAGG + Intronic
1128559251 15:68653808-68653830 TGCTGATTGTGGGGGAGTGATGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128783120 15:70376040-70376062 TGCTGATCTTGGTGGAGGGAGGG - Intergenic
1130663588 15:85850856-85850878 TTCTTGTCTTGGGGGAATGAGGG - Intergenic
1132006477 15:98232402-98232424 TGCTTATGTTGGGGCAGCAGTGG - Intergenic
1134744924 16:16580629-16580651 TAGTTGTGTTGGGGGAGGGATGG - Intergenic
1135000560 16:18773140-18773162 TAGTTGTGTTGGGGGAGGGATGG + Intergenic
1135257438 16:20952318-20952340 TGTTTATGGTGAGGGAGGGAGGG + Intronic
1135509268 16:23068474-23068496 TGCTTGTGCTGGGGGAGCGCAGG + Exonic
1136235525 16:28911319-28911341 TGCTGATGGGTGGGGAGTGAAGG - Intronic
1137434613 16:48445263-48445285 TGTGTGTGGTGGGGGAGTGAAGG + Intronic
1140127209 16:72128013-72128035 TGCTTATGATGAGGGAGAAAGGG + Intronic
1140208125 16:72949998-72950020 TACATATGTTGGTGGAATGATGG + Intronic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1140767178 16:78170985-78171007 TATTTATTTTGTGGGAGTGAAGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1142094229 16:88231057-88231079 TGCGTGTGTTGGGGGAGGGGAGG - Intergenic
1142493042 17:290753-290775 TGCCAATGTAGGGGGAGGGAAGG + Intronic
1143178862 17:4972205-4972227 TGCTTATATTGATGGAGTTATGG - Intronic
1143393906 17:6576796-6576818 TGTGTGTGTTGGGGGAGTGGGGG - Intergenic
1143854198 17:9836454-9836476 TACTTACCTTGGTGGAGTGAAGG + Exonic
1145122560 17:20273668-20273690 TGCTTCAGGTGGGGGAATGAAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146618488 17:34376236-34376258 TCCTTAGGTTGGGGGAGTCAGGG - Intergenic
1147888852 17:43702945-43702967 TCCTTATGTTGGGTGGCTGAGGG + Intergenic
1148372454 17:47110847-47110869 TGGTTGTTTTGGGAGAGTGAGGG + Intergenic
1148547947 17:48531131-48531153 TGCTAATGCTTGGGGGGTGATGG - Intergenic
1148896551 17:50842373-50842395 GGGTTATGATGGGGGAGGGAGGG + Intergenic
1149099767 17:52890362-52890384 TGCATATGTTTTGTGAGTGATGG + Intronic
1150185756 17:63179784-63179806 TCCTTATTTTGGGAGGGTGAGGG - Intronic
1152583213 17:81178209-81178231 TGCTCATGTTGGAGGTGGGAGGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1154413548 18:14158234-14158256 TGCTGATGTTGGGTGAGTTTAGG - Intergenic
1155044079 18:22088542-22088564 TGGTTATGTGGGGGAAGGGATGG + Intronic
1156713209 18:39974085-39974107 TGCTTCTGGTGGGAGAGAGAAGG - Intergenic
1156765161 18:40644330-40644352 TGTATTTGTTAGGGGAGTGATGG + Intergenic
1157401729 18:47394250-47394272 TGCATATGTTGGGTAAGTGAAGG - Intergenic
1157483372 18:48070146-48070168 TGCTTTTGCTGAGTGAGTGAAGG - Intronic
1158849430 18:61480177-61480199 TTCTTAATTTGGGGGAGGGAAGG - Intronic
1161952914 19:7477601-7477623 TGCTTGGGTCGGGGGGGTGATGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165024611 19:32950558-32950580 TGCTTTTTTTGTGGGGGTGAAGG - Intronic
1165328073 19:35125682-35125704 TGCTTCTGTGTGGGGCGTGAGGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165742233 19:38211220-38211242 TGGCCATTTTGGGGGAGTGAGGG - Intronic
1167104326 19:47421339-47421361 TGCTCAGGTTGGGGCACTGAAGG - Intergenic
1168648341 19:58076185-58076207 TGTTTATTTTAGGAGAGTGAGGG + Intronic
1168726373 19:58584595-58584617 TCCTTTCCTTGGGGGAGTGAGGG + Intergenic
925353828 2:3223288-3223310 TGCATGTGTGGGGGGAGTGCAGG - Intronic
926392164 2:12404422-12404444 GGCTGCTGTTGGGGGAGGGAGGG + Intergenic
927036948 2:19187840-19187862 TGTGTATGTTGGGGGAGTTGGGG + Intergenic
927888107 2:26730746-26730768 TGTTTATGTTGGGGGTGGGGGGG + Exonic
930510856 2:52343195-52343217 TGATGACTTTGGGGGAGTGATGG + Intergenic
932867678 2:75363015-75363037 TGCTGATGTTTGGGGTATGATGG + Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933272581 2:80249050-80249072 TGCTGATGATGGAGGAGAGAAGG - Intronic
934104812 2:88685914-88685936 TGCTGATGGTGGGGCAGTGGTGG - Intergenic
934488910 2:94744409-94744431 TGCTTATGTTAGGGATGAGAAGG + Intergenic
937297116 2:120816083-120816105 TGATGATGTTTGGGGACTGAGGG + Intronic
937909139 2:127066985-127067007 TGCTTGAGTTGGGGAAGTCAAGG + Intronic
938071811 2:128312360-128312382 TACTTGTCTTGGGGGAGTGTTGG + Intronic
938180410 2:129177227-129177249 TGCTTATGGTGGGGCACAGACGG - Intergenic
938184807 2:129221241-129221263 TGCTTATGTTGGGGAACCTATGG - Intergenic
938982783 2:136542398-136542420 TGCCTCTGTGGGGGGAGTCAGGG + Intergenic
940381516 2:153019754-153019776 AGCTCATATTGGGGGAGTGAGGG + Intergenic
941557454 2:166999135-166999157 TGCTTAGGTTGAGGGATTGAAGG + Intronic
942138333 2:172951869-172951891 TGATGATGTTGGGGCAGGGATGG + Intronic
944626149 2:201570827-201570849 GGCTGATTTTGGAGGAGTGAGGG - Intronic
944996738 2:205302790-205302812 TGCTCATGTGTGGGGAGTCATGG - Intronic
946485324 2:220095691-220095713 GGCTGAGTTTGGGGGAGTGAGGG - Intergenic
946685254 2:222262249-222262271 TTCTTATGTTGGTGGACTTAGGG + Intronic
948689950 2:239695614-239695636 AGCCTATGTTGGGGCAGGGATGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948745656 2:240091467-240091489 TGCTGATGTTTGGGGTATGAGGG - Intergenic
1170307833 20:14959512-14959534 TGCTTGTATTTGGGGAGGGAGGG - Intronic
1173528631 20:43751670-43751692 TGCTGGTGTTGGGGAATTGAGGG + Intergenic
1174533468 20:51233063-51233085 TGCTTATTTGGGGGGGGTGGGGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175240175 20:57541442-57541464 TGCTAATGTGGGGACAGTGAGGG + Intergenic
1175569238 20:60006534-60006556 TCTTTGTGTTGGGGGAGAGAGGG - Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176785238 21:13248592-13248614 TAGTTATGGTGGTGGAGTGAGGG + Intergenic
1176859472 21:14000013-14000035 TGCTGATGTTGGGTGAGTTTAGG + Intergenic
1176929609 21:14792391-14792413 TGCTTTTATTGTGGGAGTGTGGG + Intergenic
1177829937 21:26126705-26126727 TGTTTATGTTGGGTGGGGGAGGG - Intronic
1177983278 21:27942351-27942373 TAGTTATGGTGGTGGAGTGAGGG + Intergenic
1178258145 21:31074207-31074229 TGTTTGTGGTGGGGGAGTGGTGG - Intergenic
1179952779 21:44720333-44720355 TGTGAATGTTGGTGGAGTGAGGG - Intergenic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1181689979 22:24553849-24553871 TGCTCATGTTGGGGGTGATAAGG + Intronic
1181745025 22:24950300-24950322 TGGTGAGGTTGGGGGAGGGAGGG + Intergenic
1182453489 22:30434950-30434972 TGTGTGTGTTGGGGGTGTGAGGG + Intergenic
950257760 3:11520014-11520036 TGCTGATGTTGCAGGAGTGAGGG + Intronic
950696240 3:14703276-14703298 TGCTTGGGTCGGGGGAGTCAAGG + Intronic
951141633 3:19168960-19168982 TGCTCCTGTTGGCGGAGGGATGG - Intronic
953340516 3:42130696-42130718 TGCTTATGTGGGAGGAGGGAGGG + Intronic
954513951 3:51154003-51154025 TGCTTATGGTGTGTGATTGATGG + Intronic
958936614 3:100262189-100262211 TGCTTATGTTGGAGTTGGGAAGG + Intronic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960914912 3:122685444-122685466 TACAAATGTAGGGGGAGTGAGGG + Intronic
961191478 3:124965989-124966011 TGTTTGTGTTGGTGGATTGACGG - Exonic
961217198 3:125168846-125168868 TGCTTCTGCTGGGTGAGGGAGGG - Intronic
961281711 3:125769673-125769695 TGTTTATGTTGGGGATGTGGGGG + Intergenic
962012243 3:131402979-131403001 TGCTTATCTTGGAGGAATGTTGG + Intergenic
962409056 3:135125465-135125487 TGCTCCTGTTGAGGGAATGATGG + Intronic
962463627 3:135637302-135637324 TGGATAGGTTGGGAGAGTGATGG - Intergenic
964253498 3:154748045-154748067 TGGTTTTGTTGAGGGAGGGATGG - Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
965110959 3:164421630-164421652 TGGTTATTTTGGGGGATGGAGGG - Intergenic
965372377 3:167879617-167879639 TGTGTTTGTTGGGGGAGTGAAGG - Intergenic
968678153 4:1896856-1896878 TTCTTATGTTGGGGAAGGCAAGG - Intronic
969093620 4:4716101-4716123 TGCTCATTTTGAGGCAGTGATGG - Intergenic
969139283 4:5054505-5054527 GGCTCATGTGGGGGGATTGAGGG + Intronic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
969999413 4:11349618-11349640 ACCTTATGTTTGGGGAGTGGAGG + Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
973919882 4:55673977-55673999 TGCCTATGGTGGGGGAGGGGTGG + Intergenic
974684870 4:65215020-65215042 TTCTTATGTGGTGGGATTGAGGG - Intergenic
974942823 4:68489487-68489509 TGCTGGTGGTGGGGCAGTGATGG + Intronic
975624543 4:76331399-76331421 TGCTTCTGTTGGTAGAGGGATGG + Exonic
976177673 4:82371930-82371952 TGCTGGTTTTGGGGGAGTGGTGG - Intronic
976771185 4:88654194-88654216 TGATTATGTTAGTGTAGTGATGG + Intronic
978493569 4:109334613-109334635 GGCTGATGGTGGGGGACTGATGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978636991 4:110821498-110821520 AGCTTATGTTCTGGGATTGAAGG + Intergenic
981762206 4:148207020-148207042 AGCTTATGTGGGAGGAGTGCTGG - Intronic
982539973 4:156656427-156656449 TTCTTATGGTGGGGAAGGGATGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983849562 4:172563258-172563280 TGGTTATCATGGGGGAGAGAAGG - Intronic
984299250 4:177893980-177894002 TGCTCATGTTGGGGGCATGATGG + Intronic
985069805 4:186156950-186156972 TGCTATTTTTGGGGGAGAGATGG - Intronic
986159206 5:5209593-5209615 TGCTTATATTGGGAGAGAGGAGG - Intronic
986893617 5:12338956-12338978 AGCTGATGTTGGGGTAGGGAAGG + Intergenic
988360039 5:30225682-30225704 TGCTTATGTTATGGGATAGAAGG + Intergenic
988932380 5:36048915-36048937 TGTTTATGTTGGAGGCTTGATGG - Exonic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
990251251 5:53917439-53917461 TGATAATGTTGAGGGATTGAGGG - Intronic
990373511 5:55145635-55145657 TGCCTATGTTGGGGCAGAGATGG - Intronic
990754868 5:59057223-59057245 GGGTTATGCTGGGGCAGTGAGGG + Intronic
990877701 5:60504900-60504922 TGCTTTTGTTGGGGGAGGATAGG - Intronic
992691118 5:79240698-79240720 AGATTATATTGGGGGAGGGAGGG + Intronic
993074509 5:83211619-83211641 TTCTTTTGTTGGGGGAGGGGCGG - Intronic
993161697 5:84299566-84299588 TGTTTATGTTGGGACAGTGGGGG - Intronic
997266367 5:132497253-132497275 TGCTGAGGGTGGGGGTGTGAAGG + Intergenic
997293052 5:132751449-132751471 TGTTTTAGTTGGGGGAATGATGG + Exonic
998967705 5:147558782-147558804 TTCTTGTGTTTGGGGAGGGAGGG - Intergenic
999120124 5:149203029-149203051 TGGTTATGGTGGTGGTGTGATGG - Intronic
999254231 5:150200921-150200943 TGCTGATGCTGGGTGTGTGAAGG + Intronic
999298792 5:150477470-150477492 TGTGTGTGTTGGGGGAGGGAGGG + Intergenic
999779137 5:154835149-154835171 AGCTCAAGTTGGGGGAGGGAAGG + Intronic
1000027696 5:157374471-157374493 TGCTTATTTTGGGGGTATGGGGG - Intronic
1000062146 5:157667382-157667404 TGCATTTGGTGGGGGAATGAAGG - Intronic
1000252195 5:159506343-159506365 TGCTTTTGTGGAGGGAGGGAAGG + Intergenic
1000311751 5:160051769-160051791 TGCTTAAGTAAGAGGAGTGAGGG + Intronic
1001401496 5:171449027-171449049 GCCTGATTTTGGGGGAGTGAGGG + Intronic
1001706283 5:173743367-173743389 TGCCTCTGTTCTGGGAGTGAGGG - Intergenic
1002779282 6:354003-354025 TGCAGATGGTGGGGGAGTGGAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005849770 6:29812874-29812896 TGCTGATGTTGATGGAGTCACGG - Intergenic
1005899978 6:30209064-30209086 TGTTTATCTTTGGGGAGAGAAGG + Intronic
1006060468 6:31414810-31414832 GGCTGATGTTGATGGAGTGATGG + Intronic
1006072911 6:31509582-31509604 GGCTGATGTTGATGGAGTGATGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007490354 6:42216405-42216427 TGTGTGTGTTGGGGGAGTGGTGG + Intronic
1008950777 6:57156611-57156633 TGTTTATTTTGGGGGATGGAGGG - Intronic
1010070760 6:71741820-71741842 TGCATATTTTGGGGGGGTTAGGG + Intergenic
1011643939 6:89440036-89440058 TGCTCATATTGGTGTAGTGAAGG + Intronic
1012004341 6:93693831-93693853 TGCTTCAGTTGGCAGAGTGAAGG + Intergenic
1013047523 6:106502121-106502143 TGATTAAGTTGGGGGAAAGAGGG - Intergenic
1014892374 6:126858453-126858475 TGGTTTTGTTTGGGGGGTGAGGG - Intergenic
1018463546 6:164021801-164021823 TGTTTGTGTGGGGGGAGTGGGGG - Intergenic
1020824959 7:13016122-13016144 TGCTAATGATAGGGGAGTGCTGG + Intergenic
1021138620 7:16995879-16995901 TGCTAATGTTTGGGGTGTGTTGG + Intergenic
1021877482 7:25062253-25062275 TGCATAGGTTGGGGGAGGGGCGG + Intergenic
1022594345 7:31697723-31697745 TTGTTGTGTTGGGGAAGTGACGG + Intronic
1024186755 7:46957104-46957126 TGCTTATGTTAGGGGAATGAGGG + Intergenic
1025097273 7:56106194-56106216 AGCCTATGTTAGGGGAGTGTGGG - Intronic
1027265083 7:76490323-76490345 TTCTTTTTTTGGGGGGGTGAGGG - Intronic
1027607217 7:80315179-80315201 TGCTTCTGTTTGGGGATTCAAGG + Intergenic
1028641830 7:93050877-93050899 TGCTTGAGCTGGGGGAGTGGAGG + Intergenic
1029460559 7:100691784-100691806 TTCAGATGCTGGGGGAGTGAGGG - Intergenic
1032463493 7:132128772-132128794 GTCTGATGTTTGGGGAGTGAAGG + Exonic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035878446 8:3217526-3217548 TGATTTTGTTGGGGGCGTGGGGG + Intronic
1038250769 8:25902226-25902248 TGCTTGTGTGGGTGGAGTGAAGG - Intronic
1040401714 8:47057120-47057142 TGCTTATATTGGGAGATTCAAGG + Intergenic
1042115252 8:65424598-65424620 TGATTATGATGGTGGGGTGATGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1042990062 8:74629434-74629456 TGCCTAGGGTGGGGGAGTGTTGG + Intronic
1043096196 8:75976930-75976952 TTCTTATGTTGAAGAAGTGAAGG - Intergenic
1043993627 8:86786421-86786443 TGCATATGGTGGGGAAGAGAGGG - Intergenic
1044711297 8:95060932-95060954 TGTATATGGTGGGGGAGTGTGGG + Intronic
1045361485 8:101437577-101437599 GGCAGAGGTTGGGGGAGTGAGGG + Intergenic
1047366770 8:124218382-124218404 TGCTTATGTAGAGGGAGACAGGG - Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047566941 8:126055620-126055642 TGCATATGTTGGGGGGATGAGGG + Intergenic
1047746669 8:127850118-127850140 TGGGTATGTGAGGGGAGTGAGGG + Intergenic
1048803078 8:138212250-138212272 TGCAGGTGTAGGGGGAGTGATGG + Intronic
1049417573 8:142502310-142502332 TGGTGATGGTGGGGTAGTGATGG + Intronic
1052985943 9:34487928-34487950 TGCTTCTGTGAGGGGAGGGAAGG - Intronic
1053174742 9:35914608-35914630 TGCTTATCTGGTGGTAGTGAGGG + Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053918676 9:42966213-42966235 TGCTTATGTTAGGGATGAGAAGG - Intergenic
1054792343 9:69267870-69267892 AGCTTACTTTTGGGGAGTGAAGG + Intergenic
1055196496 9:73600593-73600615 TGGTTACATTTGGGGAGTGAAGG + Intergenic
1056117144 9:83451697-83451719 AGCTCATTTTGGGTGAGTGAGGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057044106 9:91871580-91871602 AGCTCTTGTTGGGGGAGTGTCGG - Intronic
1058852027 9:109021807-109021829 TGCTTTTTTTGGGGGGGTGGTGG - Intronic
1059586831 9:115616186-115616208 TTCTTTTGGTGGGAGAGTGAGGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061252667 9:129435925-129435947 TGCATATGGAGGGGAAGTGATGG + Intergenic
1061599910 9:131661410-131661432 TGGTTATGCTCGGGGAGTGGGGG + Intronic
1062184467 9:135210475-135210497 TGTTTATGGTGGGGCACTGATGG + Intergenic
1185927550 X:4164008-4164030 TGCTGAGGTTTGTGGAGTGAAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187386877 X:18857193-18857215 TGCTGATATTGGGGGAGGAAAGG - Intergenic
1187931542 X:24297794-24297816 TGCTTGTGTTGGGGGGGTTGGGG + Intergenic
1188547623 X:31326636-31326658 TGATTATGATGGGGCAGGGAAGG - Intronic
1188833591 X:34930818-34930840 TGCTGATGTTGGGAGAGTTTGGG + Intergenic
1189588347 X:42485024-42485046 TGGTAATGTAGGGTGAGTGAAGG - Intergenic
1190250640 X:48721923-48721945 ATCTTAGGTTGGTGGAGTGAAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192141657 X:68651633-68651655 TCCATATGGTGGGGGAGGGAAGG - Intronic
1192833941 X:74779600-74779622 TGCCTATGTTGGGAAAGTAAGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195121655 X:101760232-101760254 TGCTGAGGTTTGGGGTGTGATGG + Intergenic
1195661427 X:107383009-107383031 TGCTCTTGGTGGGGGAGAGAAGG - Intergenic
1196789526 X:119451499-119451521 TGCTTCTGTCGTGAGAGTGAAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199311460 X:146325669-146325691 TGGAAATTTTGGGGGAGTGATGG + Intergenic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic