ID: 969834625

View in Genome Browser
Species Human (GRCh38)
Location 4:9830570-9830592
Sequence GTGCCTAAGCAGAGTGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969834625_969834628 4 Left 969834625 4:9830570-9830592 CCCGTCTCACTCTGCTTAGGCAC 0: 1
1: 0
2: 0
3: 12
4: 157
Right 969834628 4:9830597-9830619 GATATGACCCAATATTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969834625 Original CRISPR GTGCCTAAGCAGAGTGAGAC GGG (reversed) Intronic
900322480 1:2092066-2092088 GTGCGGCCGCAGAGTGAGACAGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900831061 1:4965642-4965664 GTGCCTGAGCTGAGGGAGTCTGG - Intergenic
901754762 1:11434836-11434858 GTGCCCACGAAGAGTGACACAGG + Intergenic
908955319 1:69618433-69618455 GTGATTAAGCAGAGAGACACTGG - Intronic
911164721 1:94714365-94714387 CTCCCTCAGCAGAGGGAGACTGG - Intergenic
911608539 1:99935772-99935794 ATGCCTAAGCAGATAGGGACAGG + Intergenic
915346191 1:155198217-155198239 TTGCCTGGGCAGAGTGAGGCTGG + Exonic
916737261 1:167618785-167618807 GTGCTAAAGCAGTGTAAGACTGG - Intergenic
918681266 1:187357556-187357578 GTATCTTAGCAGAGTGAGAATGG - Intergenic
921220523 1:212970410-212970432 GGGCCTCAGCAGAGTAACACTGG - Intronic
923110442 1:230885627-230885649 GTGCCTCTGCTGAATGAGACAGG + Intergenic
1063662935 10:8046328-8046350 GTGCCTGAGGAAAGTGACACCGG + Intergenic
1067734837 10:48842288-48842310 GGGCCCAAGCAGAGAAAGACAGG + Intronic
1071841384 10:89475368-89475390 AAGCCTAAGCAGAGAGAGAGGGG - Intronic
1072312809 10:94172578-94172600 GTGCTTTAGGAGGGTGAGACAGG + Intronic
1072476870 10:95770076-95770098 GTGTTTAAACTGAGTGAGACAGG + Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1076692371 10:132230406-132230428 GCGCCTGTGCAGAGTGAGGCTGG - Intronic
1076734818 10:132453901-132453923 ATGGCTAAGCTGAGTGAGGCAGG + Intergenic
1078394835 11:10971925-10971947 TTGCCTCAGCAGGGAGAGACCGG + Intergenic
1081851976 11:46280057-46280079 GTGCCTAAGGAAAGAGAGAAAGG + Intronic
1083013193 11:59423880-59423902 GTACCTAAGCTGACTGAGATGGG + Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1093809111 12:23471173-23471195 TTTCCTAAGCACAGTGAGCCTGG + Intergenic
1098055798 12:66503792-66503814 GTGGCTATGAAGAGAGAGACTGG + Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1101901467 12:108794098-108794120 GTGCCCTAGCAGAGTTAAACAGG - Intronic
1105973339 13:25451316-25451338 GAGCCAAAGCACAGTGAGAGGGG - Intronic
1106769743 13:32950529-32950551 GTACCTAAGGAGATTGAGGCTGG + Intergenic
1112247865 13:97750677-97750699 GTGCCAAAACAGAATTAGACAGG - Intergenic
1115494335 14:33987328-33987350 GTGCCTAGGCAAAGTGACAAGGG + Intronic
1118168673 14:63363018-63363040 CAGCCTCAGCAGATTGAGACAGG - Intergenic
1118847060 14:69555400-69555422 TTGCCTAAGAAGAGTAAGACTGG + Intergenic
1120030304 14:79633390-79633412 GAACCAAGGCAGAGTGAGACAGG - Intronic
1120984093 14:90318103-90318125 TTGCCTGTGCAGAGTTAGACTGG - Exonic
1121805092 14:96811565-96811587 GTCTCTAAGAAGAGTGAGTCAGG + Intronic
1122578222 14:102755227-102755249 GGGCCTAAGGAGAGTGGGTCTGG - Intergenic
1125501890 15:40245048-40245070 TTGCCTAGGCAGAGAGACACTGG - Intronic
1126755991 15:51925339-51925361 GTGCCTAAGCAGTCAGATACTGG - Intronic
1127187344 15:56493228-56493250 CTGCCAAAGGAGAGTGGGACTGG + Intergenic
1129304235 15:74647312-74647334 GTGCCTAGACAGAGTGAGAAAGG - Intronic
1133155967 16:3876284-3876306 GTGCTTAGGGAGACTGAGACAGG - Intronic
1135846439 16:25922905-25922927 CTGCCAAAGCTGAGTGAGCCAGG - Intronic
1138517430 16:57543966-57543988 GTGCCTAGGCTGTGTGACACTGG - Intronic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1143049023 17:4107438-4107460 GAGCCTGAGCAGGGTGAGAAAGG + Intronic
1143132104 17:4685347-4685369 CTGACTAAGGAGACTGAGACAGG - Intronic
1143184966 17:5004506-5004528 GGGGCTAAGCAAAGTCAGACCGG - Intronic
1143712236 17:8742968-8742990 GTGCCTAAGCCGTGTGGGACAGG - Intronic
1147035474 17:37676642-37676664 GTGCCCCAGCAGAGTGAACCAGG - Intergenic
1147268927 17:39253204-39253226 GTCCCTGAGCAGAGTCTGACAGG + Intergenic
1148399574 17:47344115-47344137 GTGCCTGAGGTGAGTGACACTGG - Intronic
1148774428 17:50087695-50087717 GGGCCTAAGCAGGCTGACACAGG + Intronic
1150434025 17:65140268-65140290 GTCCCTAAGCACACTGAGCCAGG - Intronic
1150819254 17:68421896-68421918 GTGCCCATGCAGAGTGAGCAGGG + Exonic
1152739933 17:82014420-82014442 GTGCCTGGGCAGGGAGAGACGGG - Intronic
1154323808 18:13375537-13375559 GGGCCGAAGCTGAGTGAGATGGG + Intronic
1156622881 18:38873652-38873674 GGGCCCGAGTAGAGTGAGACTGG + Intergenic
1156685411 18:39639458-39639480 TTGCCTACCCAGAGTGAAACTGG + Intergenic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162834100 19:13304889-13304911 CTGCCTGAGCAGACTAAGACAGG + Intronic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1165090319 19:33384023-33384045 GAGCCGAAGTAGAGTGACACAGG - Intergenic
925156609 2:1653115-1653137 GTGCCAGAGCAGAGTGAGTGGGG + Intronic
925759284 2:7168856-7168878 GTGGCTCAGCATAGTGAAACTGG + Intergenic
926285750 2:11486400-11486422 GTGCTCTAGGAGAGTGAGACAGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927431195 2:23027594-23027616 GTGCCCAAGGAGAGGGAGCCAGG - Intergenic
930247353 2:48998004-48998026 GAGGCTAAACAGAGTCAGACAGG - Intronic
935121770 2:100189291-100189313 GTGCCTCAGGAAAGTCAGACTGG - Intergenic
936250515 2:110864900-110864922 GTGCCTGATCACAGTGAGGCTGG - Intronic
937569662 2:123340883-123340905 GTGACTCAGGAGACTGAGACGGG + Intergenic
939334020 2:140801896-140801918 GTTCCTAACCAGAGTGTGAAAGG + Intronic
942246948 2:174016691-174016713 GTGACTAAGGAGACTGAGAAAGG - Intergenic
942400423 2:175595725-175595747 TTGTCTCAGGAGAGTGAGACTGG + Intergenic
945989319 2:216380446-216380468 CTGCCTACTCAGAGTGAGGCTGG + Intergenic
947671507 2:231939418-231939440 GTGCTTAAGCAGATTGGGATCGG + Intergenic
948336638 2:237213524-237213546 GTGCCATGGCAGAGTGACACCGG + Intergenic
948396162 2:237646872-237646894 CAGCCTAAGCAGACTGAGACAGG + Intronic
1169188662 20:3642658-3642680 GTGCCACAGCAGAGTGGTACTGG + Intronic
1174251842 20:49225822-49225844 GCTTCTAAGAAGAGTGAGACTGG - Intronic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1176239227 20:64068204-64068226 GTGCCTAGGCACATGGAGACTGG - Intronic
1177232448 21:18340172-18340194 GTGCCTACCCAGACTGAGAGTGG - Intronic
1177566929 21:22835988-22836010 GTGCCAAAACAGAATGATACTGG + Intergenic
1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG + Intronic
1180674601 22:17578578-17578600 GTGCCCAAGCAGAGAGCGTCCGG + Intronic
1181462643 22:23094608-23094630 GTGCCTAAGCACAGTGGGCAGGG - Intronic
1181842466 22:25675677-25675699 GTGCCTGAGCAGAGGCTGACCGG - Intronic
1183266425 22:36829040-36829062 ATGCCTAAGCTGAGTCATACAGG - Intergenic
1184963834 22:47951906-47951928 GTGCCTAACCAGATTAAGAGTGG - Intergenic
1185354696 22:50360810-50360832 GTGCCAAACCTGAGAGAGACTGG - Intronic
950916954 3:16655841-16655863 GTGGCTGAGCAGAGTGAGTGAGG + Intronic
951259803 3:20494831-20494853 GTGACTCAGCACAGAGAGACAGG - Intergenic
952522939 3:34180405-34180427 ATACGTAAGCAGAGTCAGACTGG - Intergenic
958794647 3:98693854-98693876 GTGTCTTAGCAGAGTGACATTGG + Intergenic
959242295 3:103811999-103812021 GTCCCTAACCATAGTGAGAAGGG + Intergenic
962053428 3:131843289-131843311 GTGCATAAACTGAGTGGGACAGG + Intronic
962769630 3:138600481-138600503 GTGCCTAAGCAGCGGCAGCCTGG + Intergenic
962969553 3:140386193-140386215 GTGCCTGAGAAGATTGAGACAGG + Intronic
963606056 3:147412492-147412514 GTGCCAAAGTAGAATGAGAGGGG - Intronic
964861543 3:161207891-161207913 CTGCCTCAGCAGAGTGACCCCGG - Intronic
964931318 3:162028071-162028093 GTGCTTGAGCACAGTGAGCCAGG + Intergenic
965211129 3:165790955-165790977 GTGCCTACTCAGAGTAAGAGAGG + Intronic
966071235 3:175880982-175881004 GTGCCTAATCGGAGTGTGAGAGG + Intergenic
968247404 3:197166211-197166233 GAGCCTGAGCAGCGTGAGAAGGG + Intronic
968567034 4:1318447-1318469 AGGCCTCAGCAGGGTGAGACGGG + Intronic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
973229328 4:47823912-47823934 GTGCCTAAGCAGGGTAAGGATGG - Intronic
975570758 4:75815481-75815503 GTGCAAAAGCAAAGTGAGAAAGG - Intergenic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
982530948 4:156542884-156542906 GTGCCTACCCAGACTGAGAGTGG + Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
984362975 4:178761222-178761244 ATGCCTGAGCAGAGAGAAACAGG + Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
998254627 5:140575284-140575306 GTGCCTAGGCTGACAGAGACTGG - Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1002061323 5:176627635-176627657 GTGTCTAGGCAGACTGAGCCCGG + Intronic
1004239325 6:13904561-13904583 GAGCCTGAGGAGATTGAGACTGG - Intergenic
1005915888 6:30351214-30351236 GTTTCAAAGCAGAGTGAGGCAGG - Intergenic
1008603254 6:53116331-53116353 GTCCCTAAGCACTGTGTGACAGG + Intergenic
1008947328 6:57112621-57112643 GTGCCTATGATGAGTGAGATAGG + Intronic
1008975152 6:57417404-57417426 GTGACTAAGCTTAGTGAGAAAGG - Intronic
1009164036 6:60318923-60318945 GTGACTAAGCTTAGTGAGAAAGG - Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1014318303 6:119894225-119894247 CAGCCTAAGCAGAGTAATACAGG - Intergenic
1014379351 6:120720560-120720582 GTGCTTATGCAGAGTTTGACAGG + Intergenic
1014474322 6:121854017-121854039 GTCCCAAAGCAGAGGGAGAGGGG + Intergenic
1016109661 6:140206570-140206592 GTGACTAAGCAAAATGAGACTGG - Intergenic
1018040326 6:159915997-159916019 ATGTCTAGGCAGAGTGACACAGG + Exonic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1023360906 7:39414429-39414451 GTGCCCAGGCAGAGGGAGAGTGG + Intronic
1024363786 7:48498050-48498072 TTCACAAAGCAGAGTGAGACAGG - Intronic
1026113847 7:67479708-67479730 GCACCTAAGCAGAGGGAGACAGG - Intergenic
1028623360 7:92848571-92848593 GTGCCTAAGAATAGGGATACTGG + Intergenic
1028910572 7:96203041-96203063 GTGACCAAGGAGAGGGAGACCGG - Intronic
1030099718 7:105934704-105934726 GGAGCTAAGCAGAGGGAGACTGG + Intronic
1030580826 7:111352749-111352771 GTGCCAAATCAGAGTGCTACAGG - Intronic
1031312439 7:120215636-120215658 GTGCCTACACAGATTGAGACTGG - Intergenic
1033139664 7:138814216-138814238 GTGCCTCAGAAGGCTGAGACTGG + Intronic
1034540556 7:151755383-151755405 GAGCCTGAGCAGAGGAAGACAGG + Intronic
1038135367 8:24780038-24780060 GAGACTAATGAGAGTGAGACAGG + Intergenic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1043858195 8:85286039-85286061 GAACCCAAGCTGAGTGAGACAGG - Intergenic
1046438321 8:114225268-114225290 GTGTCTAACCAGAGTGAAAGAGG - Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1050580017 9:7044314-7044336 GTGTCTAAACACAGTGAGGCTGG + Intronic
1050723229 9:8615109-8615131 GTGGCTAAGCTGAGTTAGAGTGG - Intronic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1061234732 9:129335809-129335831 GAGCCTCAGCCTAGTGAGACTGG - Intergenic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1186589696 X:10916980-10917002 GTGACTGAGGACAGTGAGACAGG + Intergenic
1187082935 X:16010442-16010464 TTCCCTAAGCAGAGAGTGACGGG + Intergenic
1187096626 X:16155617-16155639 CTGCCAAAGCAGAGTGTGGCAGG + Intergenic
1187135395 X:16542693-16542715 GTACCTTAGCAGAGGGAGAAGGG + Intergenic
1188622091 X:32238231-32238253 GTGGCTTAGCAGGGTGGGACTGG + Intronic
1190131062 X:47749259-47749281 GTCCCTAACCAGCGTGAGAAGGG - Intergenic
1190787426 X:53665169-53665191 GTGGCTAAGGATAGGGAGACTGG - Intronic
1192827967 X:74718388-74718410 GTGCCCAACCACAGTGAGAGTGG - Intergenic
1193486137 X:82087126-82087148 ATGCCTAGGCAGAGAGGGACAGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1202108190 Y:21392150-21392172 GTGCCTCAGGAGGCTGAGACAGG + Intergenic
1202381384 Y:24278465-24278487 GAGCCTAAGCAGGGTGAGGTGGG + Intergenic
1202489401 Y:25391661-25391683 GAGCCTAAGCAGGGTGAGGTGGG - Intergenic