ID: 969836619

View in Genome Browser
Species Human (GRCh38)
Location 4:9847592-9847614
Sequence AACCCATGCTGGGGCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969836611_969836619 13 Left 969836611 4:9847556-9847578 CCCTCAGTGTTTGCTGGGAACGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG 0: 1
1: 0
2: 0
3: 8
4: 116
969836610_969836619 14 Left 969836610 4:9847555-9847577 CCCCTCAGTGTTTGCTGGGAACG 0: 1
1: 0
2: 1
3: 14
4: 137
Right 969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG 0: 1
1: 0
2: 0
3: 8
4: 116
969836607_969836619 26 Left 969836607 4:9847543-9847565 CCTGTCATTAATCCCCTCAGTGT 0: 1
1: 0
2: 0
3: 11
4: 97
Right 969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG 0: 1
1: 0
2: 0
3: 8
4: 116
969836613_969836619 12 Left 969836613 4:9847557-9847579 CCTCAGTGTTTGCTGGGAACGGA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969836619 Original CRISPR AACCCATGCTGGGGCATCAA TGG Intronic
900767379 1:4514291-4514313 GAACCATGCTGGGGCCTGAAAGG + Intergenic
904442281 1:30539631-30539653 AACCCAGGCTGGGGGATCTCAGG - Intergenic
908467425 1:64411323-64411345 CACCCAGGCTGGGGCATGCAGGG - Intergenic
913501286 1:119474903-119474925 AACCCATGATGTGGCTTCATTGG - Intergenic
915044343 1:152999617-152999639 AGCTCACGCTGGGGCATCAGAGG + Intergenic
915341225 1:155177906-155177928 TAGCCATGCTGTGGCATCCAAGG + Intronic
916464303 1:165058495-165058517 AACCCATTCTGAGGGATCATAGG - Intergenic
917979952 1:180263047-180263069 CACCCATGCAGGGGCACCAAGGG - Intronic
918319315 1:183349762-183349784 AACCAATGCTGGGGAAGGAAGGG + Intronic
1067324449 10:45253637-45253659 AACACAAGCTGGGGCAGCTAAGG + Intergenic
1069772039 10:70906230-70906252 ATCCCAGGCTGGGGCAGCCACGG - Intergenic
1071164636 10:82791140-82791162 AACCCATGTGGGGGCAGGAAGGG - Intronic
1072168637 10:92838741-92838763 AAACCATGCTGGGACAACACAGG - Intronic
1073489952 10:103846549-103846571 AACCCAGACTGGGGGATCAAGGG + Intronic
1078044686 11:7903041-7903063 AACCCATGTGGGTGGATCAATGG - Intergenic
1079089951 11:17473901-17473923 AACCCAGGTTGGGGCATCTCAGG - Intronic
1080715116 11:34792616-34792638 ACCACTTGCTGGGGCATGAAGGG + Intergenic
1080965623 11:37210964-37210986 ACCCCAAGCTGGGGCATCCCAGG + Intergenic
1081267007 11:41037102-41037124 TACGCAGGCTGGGCCATCAAAGG + Intronic
1084915115 11:72422915-72422937 GCCCCAAGCTGGGGCATCCAGGG + Intronic
1090558071 11:127898516-127898538 ATCCCATGCTGGGGCAGGGACGG + Intergenic
1093053595 12:14532651-14532673 AACCCATGCGTGGGCAGGAATGG + Intronic
1093192387 12:16090444-16090466 AAACAATGCTGGGCAATCAAAGG - Intergenic
1093315676 12:17647120-17647142 TACCCATAGTGGGGCATTAAAGG + Intergenic
1096660237 12:53119596-53119618 AACCCTTGATGTGGCATCCAAGG + Intronic
1096752720 12:53772312-53772334 AATCCTTGCTGAGGCATCCAGGG + Intergenic
1097147078 12:56949115-56949137 GACGCAAGCTGGGGCAGCAAAGG - Intergenic
1098078546 12:66759257-66759279 AACTCATGCTGTGGCTTCAGAGG - Intronic
1102092484 12:110203477-110203499 AACCCAGGCTTGGGGATCAGTGG - Intronic
1104663195 12:130627221-130627243 AGCCCAAGCAGGGGCACCAAAGG + Intronic
1107531390 13:41285433-41285455 AAGCCATGCTGGGTGATCCAGGG - Intergenic
1108336056 13:49443663-49443685 AACCAATGTTAAGGCATCAAAGG + Intronic
1110565867 13:76957115-76957137 TTCCCATGCTGGGGCACCCATGG + Exonic
1113601444 13:111572105-111572127 ATCCCTTCCTGGGGCCTCAAGGG + Intergenic
1113729149 13:112627206-112627228 AACCCCTGCTGTGCCATCACCGG - Intergenic
1117290706 14:54329754-54329776 AGCACATGCTGGGGATTCAAAGG - Intergenic
1117613196 14:57504977-57504999 AAACCTCGCTGGGTCATCAAAGG + Intergenic
1123780434 15:23621469-23621491 AACCCATACAAAGGCATCAAAGG + Intronic
1126462679 15:48929837-48929859 AACCTATGCTGGGGGCTGAATGG - Intronic
1129686980 15:77691913-77691935 CACCCACGCTGCGGCATCACAGG + Intronic
1130879899 15:88046070-88046092 CACCCAGGCTGGAGCATCAGTGG + Intronic
1131586708 15:93703392-93703414 AACCCAAGCCAGGGCCTCAAAGG - Intergenic
1131831987 15:96360246-96360268 ACCCCAGGCTGGGGCAGCGAGGG + Intergenic
1132573460 16:654123-654145 GACCCACGCTTGGGCATCAATGG + Intronic
1134288922 16:12887682-12887704 AACACACACTGGGGGATCAAGGG - Intergenic
1134504513 16:14794164-14794186 AAGCCATGCTGGTGCATCTGGGG - Intronic
1134576058 16:15334745-15334767 AAGCCATGCTGGTGCATCTGGGG + Intergenic
1134726384 16:16421756-16421778 AAGCCATGCTGGTGCATCTGGGG - Intergenic
1134941047 16:18290103-18290125 AAGCCATGCTGGTGCATCTGGGG + Intergenic
1136690971 16:32028779-32028801 AACTCAGGCTGTGGCTTCAAGGG - Intergenic
1136791559 16:32972341-32972363 AACTCAGGCTGTGGCTTCAAGGG - Intergenic
1136878255 16:33881591-33881613 AACTCAGGCTGTGGCTTCAAGGG + Intergenic
1137506762 16:49060709-49060731 ACCCCATGCTGGGTCATACATGG - Intergenic
1140732786 16:77871535-77871557 AAACCAGGCAAGGGCATCAAAGG - Intronic
1203093768 16_KI270728v1_random:1233802-1233824 AACTCAGGCTGTGGCTTCAAGGG - Intergenic
1144381227 17:14700796-14700818 AACCAATGCTGGGGAATGACTGG - Intergenic
1150804811 17:68310301-68310323 AACCCAACCTGGGGTTTCAAGGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1159300117 18:66552833-66552855 AACCCATGCTGGGTCATACCAGG - Intronic
1159609892 18:70513498-70513520 AACCCATGCTGAGGTCTGAAGGG + Intergenic
1162912945 19:13859478-13859500 AACCCAGGTTGAGGCCTCAATGG + Intergenic
1166141558 19:40808031-40808053 CCCCCATGATGGGGCAGCAAAGG - Exonic
1166676589 19:44745150-44745172 AACCCATCCTGGGGGAGGAAAGG - Intergenic
1166717059 19:44975250-44975272 AGCCCATTCTGGGGCCTCATTGG + Intronic
1167026350 19:46921898-46921920 AACCCATCCTGAGGCAGCCAGGG - Exonic
1167772011 19:51526773-51526795 AACCCATTCCAGGGAATCAAAGG + Intronic
927826848 2:26315337-26315359 TACCCATTCTGGGGAAACAAAGG - Intronic
930374070 2:50541817-50541839 AACAAATGCTGGACCATCAATGG + Intronic
932492539 2:72131383-72131405 AACACAGGCTAGGGCATGAAGGG + Exonic
932747306 2:74344599-74344621 AACACATGCTGGGTCACCAGAGG + Intronic
938069282 2:128300013-128300035 AGCCCAGGCTGGGGCAGCATGGG + Intronic
941378507 2:164761536-164761558 AACCCATGCTGTGAAAACAAAGG + Intronic
945338592 2:208622156-208622178 AACACATGCTGGGGCCTGTAAGG - Intronic
948425537 2:237884848-237884870 ACCCCATGCTGGGCAATCATGGG + Intronic
1169503482 20:6184023-6184045 AATACATGCTATGGCATCAAAGG - Intergenic
1170827589 20:19809728-19809750 AACACATGATGGGGCCTCATGGG + Intergenic
1172272217 20:33661015-33661037 ATCCCATGCTGGGCCATGCAGGG - Intronic
1173894866 20:46542999-46543021 AAACAATGGTGGGGCATCACCGG + Intronic
1174121339 20:48268038-48268060 AACCCATGAGGCGGCATGAAGGG - Intergenic
1174484894 20:50855024-50855046 AAGCCATGCTGGGTCATGAGGGG + Intronic
1179480166 21:41671935-41671957 AACCACTGCTGGGGCAGGAAAGG + Intergenic
1180195960 21:46194506-46194528 AACACATGCTGGGCCATGATGGG - Exonic
1182879691 22:33722843-33722865 TACCCATGCTGCGGCCTCGATGG - Intronic
1182922161 22:34090056-34090078 CACCCATGCAGGGGAAGCAATGG + Intergenic
953202621 3:40790972-40790994 ACTCCCTGCTGGGTCATCAAAGG - Intergenic
953976595 3:47386203-47386225 CACCCAGGCTGGGGTATAAATGG + Intronic
965741059 3:171874983-171875005 ACCCCACCCTGGGGCCTCAAAGG + Intronic
969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG + Intronic
971273326 4:25171925-25171947 AACCTATGCTGGAGCAACAAGGG - Intronic
978055870 4:104265198-104265220 AACCAATGGTGTGGCTTCAACGG + Intergenic
985806717 5:2050157-2050179 AATCCAGGCTGGGGAAGCAAGGG - Intergenic
985827782 5:2205392-2205414 ACGCCGTGCCGGGGCATCAATGG + Intergenic
987273956 5:16342413-16342435 TACCCATGCTGGAGGAGCAATGG - Intergenic
988677261 5:33445251-33445273 AACACTTCCTGGGGCATCACAGG + Intronic
992393395 5:76349821-76349843 CCACCATGCTGGGCCATCAATGG + Intronic
997677013 5:135720579-135720601 AACCCATTCTGGGGAACCCATGG - Intergenic
1001553842 5:172622993-172623015 GACACATGCTGGGGCCTCATGGG + Intergenic
1002076367 5:176710919-176710941 TCCCCATGCTGGGACCTCAAGGG + Intergenic
1005807812 6:29491325-29491347 ACTCCATAGTGGGGCATCAAGGG - Intergenic
1008567253 6:52781515-52781537 TACCCATGCTGGGGACACAAAGG - Intergenic
1008570689 6:52813835-52813857 TACCCATGCTGGGGTCACAAAGG - Intergenic
1008823210 6:55658897-55658919 GACCCAGACTGGGGCATCAGAGG + Intergenic
1009339540 6:62536789-62536811 AGAGCAGGCTGGGGCATCAATGG - Intergenic
1013997636 6:116326537-116326559 ATCCCATGCTGCGGCACCACCGG + Intronic
1015445664 6:133301397-133301419 AAGTCATACTGGTGCATCAAGGG - Intronic
1017985349 6:159438628-159438650 AACCCATGGTGGGGTCACAAAGG + Intergenic
1019460688 7:1156830-1156852 ACCCCATGCTGGGGCAGGAAGGG + Intronic
1024680861 7:51685917-51685939 AACCCCTGCTAGGGAATCCATGG - Intergenic
1025920411 7:65906785-65906807 AACCCATGCTGGCCCCTCAGTGG - Intronic
1031130104 7:117823641-117823663 ATCCTTGGCTGGGGCATCAAAGG - Intronic
1036691862 8:10949324-10949346 GGCCCATGCTGGGTCACCAAGGG - Intronic
1036692220 8:10951230-10951252 AACTCATGCTGGGGGGACAAGGG + Intronic
1037875892 8:22548196-22548218 GACCCATTTTGGGGCTTCAAAGG - Intronic
1038328370 8:26589222-26589244 CACCCAGGCTGGGCCACCAAGGG - Intronic
1041149339 8:54914863-54914885 AACCAAGGCTGAGACATCAAGGG + Intergenic
1042149307 8:65765141-65765163 ATCCCATGCTAGGGCAGCAGGGG - Intronic
1043259535 8:78179604-78179626 AGCTCATACTGGGCCATCAATGG - Intergenic
1046012400 8:108565421-108565443 AGCCCCTGCTGTGGGATCAATGG - Intergenic
1054813948 9:69456557-69456579 AGCCCATGCTGAGGGATCAACGG + Intronic
1060666213 9:125433562-125433584 CACCGATGCTGGGGCAGCAGAGG + Intergenic
1062617349 9:137403807-137403829 AGCCCAGGCTGGGGCATCCACGG - Intronic
1185847185 X:3448717-3448739 AGCCCATGCAGTAGCATCAATGG - Intergenic
1192710560 X:73579948-73579970 AACACATGCAGCAGCATCAAAGG - Intronic
1193260705 X:79403654-79403676 AACACAAGCTGGGGCAGCCAAGG + Intergenic
1200830435 Y:7683866-7683888 AACCCAGCCTGGGGCAACAAGGG + Intergenic