ID: 969838997

View in Genome Browser
Species Human (GRCh38)
Location 4:9866807-9866829
Sequence GTGGGTAAACTGATGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969838991_969838997 -4 Left 969838991 4:9866788-9866810 CCTAGCACCCATTTTACATGTGG 0: 1
1: 0
2: 2
3: 16
4: 153
Right 969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG 0: 1
1: 0
2: 1
3: 17
4: 226
969838990_969838997 6 Left 969838990 4:9866778-9866800 CCTCACAGCACCTAGCACCCATT 0: 1
1: 0
2: 2
3: 22
4: 269
Right 969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG 0: 1
1: 0
2: 1
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969838997 Original CRISPR GTGGGTAAACTGATGCATGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902642154 1:17773990-17774012 GTGGGTAGACTGAGGCCAGATGG + Intronic
903378681 1:22882374-22882396 GCGGCTCACCTGATGCATGATGG - Exonic
905791599 1:40792486-40792508 GTGGGGAAACTGAGGCTAGAAGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907340960 1:53736025-53736047 GTGAGGAAACTGAGGCCTGAAGG - Intergenic
907405453 1:54251107-54251129 GTGGGGAAACTGAGGCCTGCTGG + Intronic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
909073402 1:71024138-71024160 ATTGGAATACTGATGCATGAGGG - Intronic
910376174 1:86574155-86574177 GAGGGCAAACTGATACATAAAGG - Intronic
910575935 1:88763838-88763860 GTGGATAGACTGATGAATTATGG + Intronic
912186617 1:107284127-107284149 GATGGTACACTGATGCATAAAGG - Intronic
912759957 1:112357970-112357992 GTGAGGAAACGGAGGCATGAAGG - Intergenic
913673268 1:121117905-121117927 GTGGGTAAAGTTTTGCATGGGGG - Intergenic
914025044 1:143905266-143905288 GTGGGTAAAGTTTTGCATGGGGG - Intergenic
914663479 1:149812981-149813003 GTGGGTAAAGTTTTGCATGGGGG - Intergenic
915586870 1:156848720-156848742 GAGGGGAAACCGAGGCATGAAGG + Intronic
915662536 1:157416051-157416073 CTGGCTAAACTGAGGCTTGAGGG - Intergenic
915950876 1:160189295-160189317 ACAGGTAAACTGAGGCATGAGGG - Intergenic
920505585 1:206513222-206513244 ATGGGGAAACTGAGGAATGAGGG - Intronic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
921082236 1:211750806-211750828 CAGGGTAAGCTGATTCATGAGGG + Intronic
921423025 1:214970744-214970766 GTGGAAAAACTGATTTATGAGGG + Intergenic
922237128 1:223730698-223730720 GAGGATAAAATGAGGCATGACGG + Intronic
922929730 1:229379743-229379765 GTGGGCAAACTGATCCATAATGG + Intergenic
1063384381 10:5606900-5606922 GTGAGGAAACTGAGGCATGCAGG + Intergenic
1063710237 10:8470139-8470161 GTAGGTAAACTGAGTCCTGAGGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1069609295 10:69761940-69761962 GTGTGTAGACTGTTGCATGCTGG - Intergenic
1069618657 10:69822612-69822634 GTGGGTGGACTGATGGATGCGGG - Intronic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1076620391 10:131783599-131783621 GGGGATATACTGATGCAGGAAGG + Intergenic
1077151187 11:1073850-1073872 GTGGGTAAACTGAGGTCTGGGGG - Intergenic
1080872928 11:36252573-36252595 ATGGGGAAACTGAGGCTTGAGGG - Intergenic
1081346466 11:41993250-41993272 GTGGGTAAACTGAGGCAAGTTGG - Intergenic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083641684 11:64149075-64149097 ATGGGTAAACTGAGGCAAGCAGG + Intronic
1083922653 11:65788790-65788812 GTGGGGAAACTGAGGCAAAAAGG + Intronic
1084175233 11:67419385-67419407 GTGAGTAAACTGAGGCAAAAGGG - Intronic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1084658808 11:70535373-70535395 CTGGTTAGACTGATGGATGATGG - Intronic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1084937341 11:72594169-72594191 GTTGTTCAACTGATGGATGAGGG + Intronic
1086440113 11:86821137-86821159 CTGGGGAAAGTGAAGCATGAAGG - Intronic
1088374613 11:109126486-109126508 CTGGGTGAACTGATACATGTGGG + Intergenic
1091458903 12:629256-629278 GTGGGAAAACTGAAGCCGGAAGG + Intronic
1092022307 12:5212688-5212710 GTGGGCACAGTGGTGCATGAAGG - Intergenic
1093791216 12:23252578-23252600 GTGAGGAAACTGAGTCATGAGGG + Intergenic
1095600253 12:44004947-44004969 GTGGGAAAACTCATTAATGAAGG + Intronic
1097804529 12:63950903-63950925 GTGGGGCAACTAATGCATAATGG - Intronic
1101595451 12:106160695-106160717 GTGGGGAAATTGATTCATGGAGG - Intergenic
1101826188 12:108221815-108221837 GTGGGGAAACTGAGGCCTGGAGG + Intronic
1102649732 12:114431099-114431121 GTGGGTAAACTGAGGCTCAAAGG + Intergenic
1102951144 12:117032505-117032527 GTGTGTGAAATGGTGCATGAGGG + Intergenic
1105452605 13:20513511-20513533 GTAGGGAAACTGAGGCATGGAGG + Intronic
1110743317 13:79023075-79023097 ATGAGTCAACTGATCCATGATGG - Intergenic
1116112358 14:40602774-40602796 GTGGATAAAGTGATGCATTTTGG + Intergenic
1118389812 14:65286789-65286811 GTGGGTAAAATGTTCCATGATGG + Intergenic
1122517701 14:102320073-102320095 GTGGGGAAACTGAGGCCCGAAGG + Intronic
1123083176 14:105705632-105705654 GTGGATGGACTGATGGATGATGG - Intergenic
1123823049 15:24051061-24051083 ATGGGGAAACTGATGCATATTGG + Intergenic
1125952611 15:43766033-43766055 TTGGGTAAACTTGTTCATGAGGG - Intronic
1126981921 15:54254504-54254526 GTGGTTAAACTAATGAATGAAGG + Intronic
1127692532 15:61412188-61412210 GGTGGAAAACTGATGGATGAAGG + Intergenic
1127854457 15:62943032-62943054 GGGGGTAAAATGATGCAAAAAGG + Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1129062836 15:72873986-72874008 TTGGGAAAAGTGACGCATGAGGG - Intergenic
1132609382 16:807647-807669 GTGGGGAAACTGAGGTAAGACGG + Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1133671141 16:8022049-8022071 GTGGGTATACTGAGGGTTGAAGG + Intergenic
1134105944 16:11486134-11486156 GTGGGTAGACGAATGAATGATGG + Intronic
1134684813 16:16150990-16151012 GTGGGGAAACTGAGGCACAAAGG - Intronic
1134834965 16:17353648-17353670 ATGGGTAGAGAGATGCATGATGG - Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135918667 16:26628282-26628304 ATGGATACATTGATGCATGAAGG - Intergenic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1141110230 16:81265822-81265844 GTGGGTAGATGGATGAATGATGG - Intronic
1141894337 16:86948936-86948958 ATGGGGAAACTGAGGCATGAGGG + Intergenic
1142230422 16:88897626-88897648 GTGGGGAAACTGAGGCACGGGGG + Intronic
1145166973 17:20621430-20621452 GTGACTAGAATGATGCATGAGGG + Intergenic
1145249938 17:21291782-21291804 GTGAGTAAACTGAGGCCTGGTGG + Intronic
1146650511 17:34603374-34603396 GTGGGGAAACTGAGGCGAGATGG + Intronic
1149010484 17:51851417-51851439 GTGAGGAAACTGAGGCAAGATGG - Intronic
1150510928 17:65752383-65752405 CTGGGCAAACTGATCCAAGAGGG - Intronic
1151624187 17:75266447-75266469 ATGGGTAAACTGAGGCACCAAGG + Exonic
1151877256 17:76873787-76873809 GTGGGGAAACTGAGGCAAGTAGG + Intronic
1153698349 18:7666725-7666747 GTGGGAAAAATGTTGCTTGAAGG - Intronic
1155472150 18:26202572-26202594 TTTGTTAAACTGATGCTTGAAGG - Intergenic
1158425539 18:57336948-57336970 ATGGGTTAACTGATGAATAAAGG - Intergenic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1160926664 19:1549877-1549899 GTGGGTGAATTGATGGATGGAGG - Intergenic
1160965182 19:1744312-1744334 GTGAGCAAACTGAGGCCTGAGGG - Intergenic
1161702562 19:5803575-5803597 GTGGGGAAACTGAGGCACGGGGG + Intergenic
1162395694 19:10417116-10417138 GGGGGTAAACTGAGGCACGAGGG - Intronic
1162509735 19:11110834-11110856 ATGGGGAAACTGAGGCATGAGGG - Intronic
1162582006 19:11537142-11537164 GTGGGGAAACTGAGGCACGGGGG - Intergenic
1162695233 19:12468470-12468492 TTTGGTAAACAGATGCTTGAAGG + Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163530910 19:17848277-17848299 ATGGGTAAACTGAGGCAATAAGG - Intergenic
1164261029 19:23568735-23568757 GTGCTTAAACAGATGCTTGAAGG + Intronic
1165396044 19:35563988-35564010 ATGGGGAAACTGAGGCATGGAGG + Intergenic
1165890726 19:39110655-39110677 GCTGGGAAACTGAGGCATGAAGG - Exonic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167174187 19:47853972-47853994 GTGGGGAAACTGATCCTGGAGGG + Intergenic
1168074968 19:53975998-53976020 GTGGGGAAACTGAAGCAAGCTGG + Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
928216975 2:29369971-29369993 GTGTGTCAACTAATGCACGAGGG - Intronic
928407421 2:31025214-31025236 GTGGGGAAACTGAGGCATAAAGG + Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
931230984 2:60374678-60374700 GTGAGTAAACTGAGGCACGGTGG + Intergenic
932095750 2:68846915-68846937 GTGGATAGACTGATGGATGGTGG + Intergenic
932319468 2:70810795-70810817 CTGGGGAAAGTGAAGCATGAAGG - Intronic
933154302 2:78954866-78954888 CTGGGTAAACTTATATATGATGG - Intergenic
934950292 2:98571266-98571288 GTGAGGAAACTGAGGCATGGAGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
937259050 2:120573809-120573831 ATGGGGAAACTGAGGCATGTTGG + Intergenic
937304107 2:120860640-120860662 GTGGGTCAAAAGATGCAGGAGGG + Intronic
937915306 2:127095987-127096009 GTGGGTACACTGAGGCTTGGTGG + Intronic
939499881 2:142970583-142970605 GTAGGTAAATTGATGAATAAAGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
942355846 2:175108948-175108970 TTTGTTAAACAGATGCATGAAGG + Intronic
943727215 2:191264917-191264939 GTGAGGAAACTGAGGCTTGAAGG + Intronic
943778639 2:191796238-191796260 ATGAGAAAACTGATGCGTGAAGG - Intergenic
944247877 2:197550627-197550649 CTGGGGAAAGTGAAGCATGAAGG + Exonic
946187210 2:217987874-217987896 GTGGGTGAATGGATGGATGAGGG + Intronic
946680383 2:222208547-222208569 GTGTGTTAAGTGATGAATGAGGG - Intronic
946937837 2:224739682-224739704 CTTGGTAAACTGAAGCAAGAGGG - Intergenic
947924115 2:233905922-233905944 GTGGGTTTACTGATGGATGTAGG - Intergenic
948700267 2:239755219-239755241 GTGGGTGGGCTGATGCATGGTGG + Intergenic
948818720 2:240527472-240527494 ATGGGTGGACTGATGGATGAAGG + Intronic
1171249041 20:23634862-23634884 GTGGGTAGATAGATGTATGAGGG - Intronic
1171255701 20:23687805-23687827 ATGGGTAAACTGATACTCGAGGG - Intronic
1172178083 20:32984705-32984727 GTGGGGAAACTGAGGCCTGAAGG - Intronic
1175018992 20:55824466-55824488 CTGGGAAAACTGAGGCATGGAGG - Intergenic
1175184953 20:57173817-57173839 GTGGGCAAACCGAGGCATGGAGG - Intronic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175271512 20:57737344-57737366 ATGGGTAAACTGAAGCCTGCAGG - Intergenic
1175967374 20:62666271-62666293 GTGGGGAAACTGAGGCATAGAGG - Intronic
1178030905 21:28524729-28524751 GTGTTTAAACTCCTGCATGATGG - Intergenic
1178499117 21:33111015-33111037 GTGGGTAAACTGAGGTACGGGGG + Intergenic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179730118 21:43363025-43363047 CTGGGCAAACTGATTTATGATGG + Intergenic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1182347348 22:29675622-29675644 GTGTCTACACTGATGCTTGAAGG + Intronic
1182549392 22:31092775-31092797 ATGGGTAAACTGAGGCAAGTTGG - Intronic
1183064473 22:35353586-35353608 GTGGGTGAACTGAGGAATGGGGG + Intergenic
1184344855 22:43907133-43907155 GTGGGGAAACTGAAGCAGCAAGG + Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184479016 22:44736457-44736479 GTGGGGAAACTGAGGCACGGGGG + Intronic
1184744691 22:46449451-46449473 GTGGGTGGGTTGATGCATGATGG - Intronic
950220131 3:11188969-11188991 TTTGGCAAACTTATGCATGAAGG - Intronic
952223647 3:31351277-31351299 GTGAGAAAACTGAAGCATAAAGG - Intergenic
952742303 3:36746477-36746499 GTAGGAAAACTGAGGGATGAGGG - Intergenic
953406275 3:42661390-42661412 GTGGGAAAACTGAGGCCAGACGG + Intronic
955438186 3:58926645-58926667 ATGGGAAAAATGATCCATGAGGG + Intronic
955942075 3:64156117-64156139 ATGTGGAAACTGAGGCATGAAGG + Intronic
956452711 3:69390301-69390323 GTGGGTAAACTGACAGATCATGG + Intronic
959116496 3:102184469-102184491 GAGGGTAAACTGAGGCAAGTGGG + Intronic
961753540 3:129112492-129112514 GTGAGGAAACTGATGCAAGGAGG + Intronic
968636950 4:1685438-1685460 GTGGGCAGACAGATGCATGGAGG + Intergenic
969208236 4:5665046-5665068 GTGGGTAATGGGATGCATGTGGG + Intronic
969584711 4:8085035-8085057 GTGGGGAAGCTGAGGCATGCGGG + Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG + Intronic
971406982 4:26330667-26330689 GTGCTTAAAGTGAGGCATGATGG + Intronic
977141766 4:93382353-93382375 GTGGACAAACAGATGCATTATGG - Intronic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
988552487 5:32209412-32209434 TTGGTTAAACAGATGCTTGAAGG + Intergenic
988736195 5:34023763-34023785 GTGGCCATACTGGTGCATGAGGG + Intronic
990677961 5:58209464-58209486 ATGGGCACACTGATGCATTATGG - Intergenic
991056878 5:62330491-62330513 GTTGGTAAACAGATGCTTGAAGG - Intronic
993657416 5:90594702-90594724 TTTGTTAAACTGATGCTTGAAGG - Intronic
993899638 5:93575839-93575861 GTGTGCATACTTATGCATGAGGG + Intergenic
993921109 5:93803653-93803675 GTAGGTAAACTTGTGTATGAGGG - Intronic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
999435486 5:151560045-151560067 GTTGGAAAACTGTTGGATGAGGG - Intronic
999773486 5:154792906-154792928 ATGGGGAAACTGATGGATGTAGG + Intronic
1000181157 5:158812621-158812643 GTGTTGAAACTGATGCATGGGGG - Intronic
1001145793 5:169183306-169183328 GAGAGTACACTGATGTATGAAGG + Intronic
1001701823 5:173712356-173712378 GTGTTTAAACTGATTCCTGAAGG + Intergenic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1004585568 6:16996424-16996446 GTGGGTAAACCCATGCCTAAGGG - Intergenic
1005797931 6:29387244-29387266 CTGGATAGGCTGATGCATGAAGG + Intronic
1007228760 6:40333485-40333507 GTGAGGAAACTGAGGCATGGGGG - Intergenic
1007305838 6:40903810-40903832 ATGGAAAAGCTGATGCATGAAGG - Intergenic
1018052525 6:160023600-160023622 GTGGGGAAGCTGAGGCATGGAGG + Intronic
1019564872 7:1674256-1674278 GTGGGGAAACTGAGCCATGGAGG + Intergenic
1020080722 7:5284415-5284437 GTGGGGAAACTGAGGCCTGAGGG + Intronic
1024199471 7:47091106-47091128 ATGGGAAAACTGAGGCCTGAAGG - Intergenic
1025198204 7:56947762-56947784 GTGGGGAAACTGAGGCCTGAGGG - Intergenic
1025673744 7:63629174-63629196 GTGGGGAAACTGAGGCCTGAGGG + Intergenic
1025979038 7:66392950-66392972 TTGGTTAAACAGATGCTTGAAGG - Intronic
1026647431 7:72184327-72184349 ATGGGGAAACTGAGGCATGGAGG - Intronic
1030069550 7:105687181-105687203 TTCTATAAACTGATGCATGAGGG + Intronic
1031402027 7:121336673-121336695 GTTGGTAAACTGAATCAAGAGGG - Intronic
1031997957 7:128245268-128245290 GTGTGTGAACTGAGGCCTGAAGG - Intronic
1033193289 7:139303550-139303572 ATGGGTAATCTGAGGCACGAAGG - Exonic
1033202836 7:139388722-139388744 ATGGGAAAACTGATCTATGAGGG - Intronic
1033565728 7:142575907-142575929 TTTGTTAAACTGATGCTTGAAGG + Intergenic
1034780235 7:153872693-153872715 ATGGGGAAACTGAGGCATGGGGG + Intergenic
1036743995 8:11391134-11391156 CTGGGTAAGCTGATGCAAGAGGG - Intronic
1037239051 8:16756625-16756647 GTGAACAAAGTGATGCATGATGG - Intergenic
1038504190 8:28070475-28070497 GTCTGTAATCTGAAGCATGAGGG + Intronic
1038901091 8:31844629-31844651 GTGAGTAAACTGATGCTCAAAGG - Intronic
1043207736 8:77468342-77468364 TTGGGTTACCTGCTGCATGAAGG + Intergenic
1043358724 8:79444227-79444249 ATGGGTAAACTGATACAGAATGG - Intergenic
1043775095 8:84256873-84256895 GTGGGTAAAGTTATGGATCAGGG - Intronic
1044434007 8:92140942-92140964 GTGGGTGAAATGGGGCATGAGGG - Intergenic
1045545022 8:103120907-103120929 TTGGGTAAACAATTGCATGATGG + Intergenic
1045726494 8:105179465-105179487 GTGGGTAAAGAAATGCATGGAGG - Intronic
1047448631 8:124942538-124942560 GTAGGGAAACTGAGGCATGCAGG + Intergenic
1047847597 8:128825199-128825221 TTTGGTAAACAGATGCTTGAAGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1050132630 9:2428526-2428548 TTGGTTAGACTGATGCTTGAGGG - Intergenic
1050162918 9:2736468-2736490 GAGGGTTAACTGATACATAAAGG + Intronic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1056500738 9:87206358-87206380 GTAGGCAAATTCATGCATGATGG + Intergenic
1056650146 9:88452239-88452261 ATGAGGAAACTGATGCATGGAGG + Intronic
1056897880 9:90567691-90567713 GTGAGTATACTGATGAATGGAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059796691 9:117705215-117705237 GTTGGTAATCTTATTCATGATGG + Intronic
1061123536 9:128659142-128659164 GGTGGTAAACTGAGGCCTGAGGG - Intergenic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1062046723 9:134427769-134427791 AGGGGGAAACTGAGGCATGAGGG - Intronic
1185497379 X:565747-565769 ATGGGTAGATGGATGCATGATGG + Intergenic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1186046548 X:5542932-5542954 GTGTGAAAACTAATACATGATGG - Intergenic
1186862496 X:13687319-13687341 GTTGGTAAGCTGATGCAAGTTGG - Intergenic
1189208515 X:39262862-39262884 GTGGGTAAGCTGATGCCCAAGGG - Intergenic
1190414858 X:50171099-50171121 ATGGGTAAACTGAGGCACGGGGG - Intergenic
1192349253 X:70342627-70342649 GAGAGCACACTGATGCATGAAGG - Intronic
1192966632 X:76183566-76183588 GTGGGCAAACTGAAGCAAGGTGG - Intergenic
1194649758 X:96500671-96500693 GTGGTTAAAGAGATGCATGTTGG + Intergenic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1196765961 X:119243165-119243187 GTGGGCAAACTGCTGAAGGAGGG + Exonic
1197597854 X:128488696-128488718 GTGGTTAAATTCATGCATCAAGG - Intergenic
1199720111 X:150537266-150537288 GTGGGGAAACTGATGCATGGGGG - Intergenic