ID: 969842082

View in Genome Browser
Species Human (GRCh38)
Location 4:9890097-9890119
Sequence TTTAGAGATGAGGCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 355}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969842075_969842082 13 Left 969842075 4:9890061-9890083 CCACAACACCCCTGGATGAAGGG 0: 1
1: 0
2: 3
3: 21
4: 199
Right 969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG 0: 1
1: 0
2: 5
3: 63
4: 355
969842079_969842082 3 Left 969842079 4:9890071-9890093 CCTGGATGAAGGGACGACTGTTT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG 0: 1
1: 0
2: 5
3: 63
4: 355
969842078_969842082 4 Left 969842078 4:9890070-9890092 CCCTGGATGAAGGGACGACTGTT 0: 1
1: 0
2: 0
3: 5
4: 118
Right 969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG 0: 1
1: 0
2: 5
3: 63
4: 355
969842077_969842082 5 Left 969842077 4:9890069-9890091 CCCCTGGATGAAGGGACGACTGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG 0: 1
1: 0
2: 5
3: 63
4: 355
969842073_969842082 14 Left 969842073 4:9890060-9890082 CCCACAACACCCCTGGATGAAGG 0: 1
1: 1
2: 0
3: 11
4: 127
Right 969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG 0: 1
1: 0
2: 5
3: 63
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969842082 Original CRISPR TTTAGAGATGAGGCCCGGAG AGG Intronic
900920129 1:5664736-5664758 ATTAGAGCTGAGACCCTGAGGGG - Intergenic
901643116 1:10703051-10703073 TGCAGAGAGGAGGCCTGGAGGGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902522940 1:17031926-17031948 TTTAAAGGTGAGGCCCAGAGAGG - Intronic
902797588 1:18809415-18809437 TTTATAGATGAGGCATGGAAAGG - Intergenic
903374140 1:22855167-22855189 AGTAGAGCTGAGGCCCAGAGTGG + Intronic
903384431 1:22917232-22917254 TTTGGAGATGAGCCCCTGATGGG - Intergenic
903489698 1:23719058-23719080 TTTACAGATGAGGCTCAGGGAGG + Intergenic
903629365 1:24755254-24755276 AGTAGAGATGGGGCCAGGAGTGG - Intronic
903737855 1:25541756-25541778 TTTACAGATGAGGCTCAGAAGGG + Intergenic
903807279 1:26014372-26014394 TTTACAGATGAGGTTCAGAGAGG - Intergenic
903851210 1:26307199-26307221 TTTACAGATGAGGCTCTGGGAGG - Intronic
903974789 1:27142300-27142322 TTTCCAGTTGAGGCCCAGAGAGG - Intronic
904775989 1:32906867-32906889 GTGAGAGATGAGGCCTGTAGGGG + Intergenic
905312613 1:37060651-37060673 TGGAGAGATGAGGGCTGGAGGGG - Intergenic
905726910 1:40259792-40259814 TGTAGAGATGTTGCCCGGGGTGG + Intronic
906516203 1:46440266-46440288 GTTAGAGATGAGGTTGGGAGAGG + Intergenic
907314172 1:53558042-53558064 ATGAGAGATGAGGTCTGGAGGGG + Intronic
907331571 1:53675325-53675347 TTTAGAGATGTGGCTCAGAGAGG + Intronic
907565158 1:55427431-55427453 TTTAGAGATGAATCCTGGAGGGG - Intergenic
907771225 1:57466467-57466489 TTAATAGATGAGGCTCAGAGGGG - Intronic
908173097 1:61527411-61527433 TTTATAAATGAGGCACAGAGAGG - Intergenic
911014099 1:93313674-93313696 TTTAAAGATAAGGCCTGGGGCGG + Intergenic
911626870 1:100133753-100133775 TTTAGACTTGAGGCCCGGCGCGG + Intronic
912507715 1:110167490-110167512 TTTGCAGATGAGGCACAGAGAGG - Intronic
912567884 1:110601481-110601503 TGTAGAGAGGAGGCCCGGGGTGG + Intronic
913233885 1:116764116-116764138 TTCAAACATGAGGCCCTGAGAGG - Intronic
914249525 1:145910229-145910251 TATAGAGATGAGGCCTCCAGGGG - Intergenic
915896449 1:159814923-159814945 TTTGCAGATTAGGCCCAGAGAGG - Intronic
916026067 1:160834639-160834661 GTTAGAGAAGAGGCCAGGCGCGG - Intronic
916080887 1:161231350-161231372 TGTAGCGAAGAGGCCCGCAGAGG + Exonic
918559330 1:185845509-185845531 TTTAGAGATGTGGCCAGATGCGG - Intronic
919989560 1:202699907-202699929 TTTAAAGACAAGGCCCAGAGAGG - Intronic
920834197 1:209492930-209492952 TTTAGAGAAGAGACAAGGAGTGG - Intergenic
921148008 1:212377815-212377837 TTTGGAGAGGAGGCAGGGAGTGG - Intronic
922460777 1:225813016-225813038 TTTACAGATGAGGTCCAGAGAGG - Intronic
922820850 1:228484431-228484453 TTTAGAAATGTGGCTGGGAGAGG - Intergenic
1063448807 10:6137364-6137386 TTCAGGGATGAGGCCAGGTGTGG + Intergenic
1065470313 10:26073279-26073301 TTTTTGGATGAGGCCGGGAGTGG + Intronic
1067072406 10:43143604-43143626 TTTTGAGAGGAGGCCCTGAGAGG + Intronic
1067166183 10:43868143-43868165 TCCAGAGATGAGGCCCTGATGGG - Intergenic
1067736181 10:48852742-48852764 TTGAGTGATGAGGACGGGAGAGG - Intronic
1068342913 10:55732309-55732331 TTTATATATGAGGCCAGGTGCGG - Intergenic
1068527653 10:58148595-58148617 TGCAGAGATGAGGCCGGGCGTGG + Intergenic
1069274461 10:66572090-66572112 TCCAGATATGAGGCCGGGAGTGG + Intronic
1069886044 10:71624226-71624248 GACAGAGATGAGGCCCAGAGAGG - Intronic
1070691423 10:78529778-78529800 TTTATAGATGTGGCTCAGAGAGG + Intergenic
1070783548 10:79150597-79150619 TCTACAGATGAGACCCAGAGTGG - Intronic
1071997881 10:91164167-91164189 TGCAGTGATGACGCCCGGAGGGG + Intronic
1072760527 10:98052598-98052620 TTAAGTGATGAGGCTCAGAGAGG - Intergenic
1073265801 10:102227771-102227793 TCTAGAGAAGAGGCAGGGAGTGG - Intronic
1073796665 10:106995936-106995958 TGTAGAAATGAGGCCAGGTGCGG + Intronic
1073966195 10:108993123-108993145 TTAAAAGTTGAGGCCGGGAGTGG + Intergenic
1074445595 10:113518887-113518909 CTTACATATGAGGCCTGGAGAGG + Intergenic
1074889922 10:117727145-117727167 TTTATAGATGAGGCATAGAGAGG - Intergenic
1075384777 10:122047677-122047699 TTTAGAGCTGAGGCTCTGAGAGG - Intronic
1075834696 10:125443659-125443681 TGTACAGATGAGGCACAGAGAGG - Intergenic
1075954871 10:126514782-126514804 TTTAGAGATGGGGGGTGGAGAGG - Intronic
1076725047 10:132409303-132409325 ATTAGAGCTGAGGTCCGGGGCGG + Intronic
1080791028 11:35522796-35522818 TTTACAGATGAGGTTCAGAGAGG - Intronic
1081733101 11:45385121-45385143 TGTCTACATGAGGCCCGGAGAGG + Intergenic
1082079129 11:47998464-47998486 TTTAGAGATGAGGCACAGAGAGG + Intronic
1082737861 11:56876315-56876337 TTAACAGATGAGGCACAGAGAGG - Intergenic
1083064869 11:59914242-59914264 TTGAGAGCTGAGGCCAGGCGTGG + Intergenic
1083804940 11:65067857-65067879 TGCAGAGAGGAGGCCCAGAGAGG - Intronic
1083905112 11:65663873-65663895 TTTGGGGATGAGGCCTGGGGTGG - Intergenic
1084224710 11:67708730-67708752 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084262529 11:67988595-67988617 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1085197841 11:74683159-74683181 TTTACAGATGAGGCCCAGGGAGG - Intergenic
1085405630 11:76260160-76260182 TGTACAGTTGAGGCCCAGAGAGG + Intergenic
1085423351 11:76381997-76382019 GTTCGAGATGATGCCCGAAGTGG + Exonic
1085749867 11:79152347-79152369 TTTACAGAGGAGAACCGGAGAGG + Intronic
1086048720 11:82564087-82564109 TTAAGAGCTGAGGCCTGGAGAGG + Intergenic
1086116311 11:83254709-83254731 TTTAAAGATGAGGCCAGGTGCGG - Intronic
1086542204 11:87926425-87926447 TTTACAGATGAGGCACAGAAAGG - Intergenic
1087891966 11:103545593-103545615 TTTAGAGATGTTGCCCAGACTGG - Intergenic
1088559698 11:111100936-111100958 TTTACAGATGAGGCACAGAAAGG - Intergenic
1088768520 11:113009642-113009664 TTTAGAGATGAGTCCTAGAGAGG - Intronic
1088787593 11:113196635-113196657 TTTACAGATGAGACACTGAGAGG + Intronic
1089050899 11:115545004-115545026 GTTAGAGATGAGAGCAGGAGAGG + Intergenic
1089338833 11:117744195-117744217 TTTTGAGATGACGCTCAGAGAGG + Intronic
1090384438 11:126348360-126348382 TTAAGTGGTGAGGCCTGGAGAGG - Intergenic
1090800303 11:130166918-130166940 TTTAAAAATGAGGCCGGGTGCGG + Intronic
1091315149 11:134609470-134609492 TGGAGAGATGAGTCGCGGAGGGG + Intergenic
1091774173 12:3173523-3173545 TTTAGAGATGAGGGCCAGGCTGG + Intronic
1091842166 12:3628980-3629002 TTCACAGATGAGGGCCAGAGAGG + Intronic
1092866460 12:12766074-12766096 TTAAGAGATAAGGTCCTGAGAGG - Intronic
1093064991 12:14648248-14648270 TTTAAAGATGAGGCTAGGTGCGG - Intronic
1093941884 12:25064103-25064125 TTTAGAGATGTTGCCCGGGCTGG - Intronic
1094007753 12:25773449-25773471 TATATAGATGAGGCCAGGAGCGG - Intergenic
1094189061 12:27678567-27678589 TTAAGAGACGAGGCCAGGCGTGG + Intronic
1095160883 12:38913692-38913714 TTTAGAGAGTAGGCTGGGAGTGG - Intergenic
1095631306 12:44380248-44380270 TTTAGAGCTGGGGCCAGCAGAGG + Intronic
1095967779 12:47880436-47880458 TTTACAAATGAGGCCCAGAGAGG + Intronic
1096816547 12:54205383-54205405 TACAGAAATGAGGCCAGGAGAGG + Intergenic
1099586998 12:84531941-84531963 GTTAGAGAAGGGGCCTGGAGGGG + Intergenic
1101851091 12:108402980-108403002 TTTACAGATGAGGCTCAGAGAGG - Intergenic
1102148969 12:110675613-110675635 TTTAGAGATGGGACTGGGAGTGG + Intronic
1102430303 12:112877964-112877986 TTGAGAGATGAGGCTCCAAGAGG + Intronic
1102633574 12:114302794-114302816 TTTACAGATGAAGCTCAGAGAGG + Intergenic
1103162328 12:118739868-118739890 TTTATAGATAAGGCTCAGAGAGG + Intergenic
1103594630 12:122016799-122016821 TTTACAGATGAGGCACAGAGAGG + Intergenic
1103831885 12:123786845-123786867 TATATAGATGAGGCCGGGTGCGG + Intronic
1104169461 12:126266049-126266071 TTTACAGATGAGGCACAGAGAGG + Intergenic
1104864975 12:131948026-131948048 TGTAGAGATGAGGCCCAGGCTGG + Intergenic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1105898750 13:24739830-24739852 CCTAGAGCTGAGGCCCAGAGGGG + Intergenic
1106088001 13:26560107-26560129 TTGAGAGATTCGGCCGGGAGCGG - Intronic
1107298442 13:38939875-38939897 GTTAGAGGTGGGGCCTGGAGAGG - Intergenic
1110928648 13:81187453-81187475 TTTAAAAATGAGGCCTGGTGCGG - Intergenic
1111046698 13:82823189-82823211 TTTAGAGGTGAGCCCCGGACCGG - Intergenic
1114167757 14:20239115-20239137 TTTACAAATGAGGCTCAGAGAGG - Intergenic
1114524678 14:23360192-23360214 TTTGTAGATGAGGTCAGGAGAGG + Exonic
1116946974 14:50844872-50844894 TTTAAAAATTAGGCCAGGAGTGG - Intergenic
1117148036 14:52855110-52855132 TTTATAGATGAGGCTCGGGGAGG - Intergenic
1118233715 14:63979610-63979632 TTTAGAGATGAGGTGGGGTGGGG + Intronic
1118571781 14:67201437-67201459 TTTAGATGTGAGGCCCTGAGGGG - Intronic
1118582640 14:67318765-67318787 TTTAGATATTAGGCCGGGCGCGG + Intronic
1118604703 14:67494349-67494371 TTTAGAAATGAGACCCAAAGAGG + Intronic
1119160547 14:72448882-72448904 TTTAAAGATTAGGCCCAGAGAGG - Intronic
1119655656 14:76414898-76414920 CTTACAGATGAGGCCCTGAGAGG - Intronic
1119894523 14:78208696-78208718 CTTACAGATGAGGCTCAGAGAGG - Intergenic
1119917857 14:78418856-78418878 GTTACAGATGAGGCACAGAGAGG + Intronic
1121045413 14:90784265-90784287 ATATGAGATGAGGCCGGGAGCGG + Intronic
1121173128 14:91870912-91870934 TTGAGAGATGAGCCCCAGAGGGG - Intronic
1121695470 14:95908770-95908792 ATTACAGATGAGGACCAGAGAGG + Intergenic
1122241429 14:100370670-100370692 TTTATAGATGAGGCACAGAGGGG + Intronic
1122309423 14:100785175-100785197 TTGAGAGACGAGGCTGGGAGGGG - Intergenic
1122686801 14:103512440-103512462 TTTAGGGAGGAGGCCGGGTGTGG - Intergenic
1124516045 15:30368118-30368140 TGGAGAGCTGAGGCCCGAAGAGG - Intronic
1124726875 15:32162613-32162635 TGGAGAGCTGAGGCCCGAAGAGG + Intronic
1126020501 15:44396062-44396084 TTTAGCCATGAGGCCAGGTGTGG + Intronic
1126141142 15:45439849-45439871 TTTAGTTATCAGGCCCAGAGAGG - Intronic
1126305471 15:47250737-47250759 TTGAGAGCTGAGGACCAGAGGGG + Intronic
1126311783 15:47325564-47325586 TTTAGAGATGAGGCCTTGGAAGG - Intronic
1126787075 15:52186067-52186089 TCAAGAGATGAGGCCAGGTGTGG - Intronic
1127098556 15:55537602-55537624 AATAAAGATGAGGCCCAGAGCGG - Intergenic
1128326757 15:66729060-66729082 CTTACAGATGGGGCCCTGAGAGG + Intronic
1128499285 15:68216201-68216223 GAGAGAGATGAGGCCAGGAGTGG - Intronic
1129297161 15:74605950-74605972 TTTACAGATAAGGCCCAGAGAGG + Intronic
1129879442 15:78997098-78997120 TTTATGGATGAGGCTCAGAGCGG + Intronic
1130056904 15:80533843-80533865 TTTACTGATGAGGCCCCAAGAGG + Intronic
1130363334 15:83209858-83209880 TTTAGAGATGAGATCTTGAGTGG + Intergenic
1130918274 15:88323143-88323165 TGTATAGATAAGGCCCAGAGAGG + Intergenic
1130988376 15:88859562-88859584 GTTACAGATGAGGCTCAGAGAGG - Intronic
1132163209 15:99562473-99562495 TTTGGAGATGAGGGCGGGAGGGG + Intergenic
1132315205 15:100885110-100885132 CTTATAGATGAGACCCGGAGGGG - Intronic
1132595593 16:747795-747817 TGTGGAGATGAGGCCCGAGGTGG + Intronic
1133773485 16:8881246-8881268 TTTACAGATGAGGCAGGGAGGGG + Intergenic
1134033866 16:11014826-11014848 ATTGGAGTTGGGGCCCGGAGTGG + Intronic
1134091619 16:11394431-11394453 CTTGGAGCTGAGGCCCAGAGAGG - Intronic
1134122988 16:11597820-11597842 TTTATAGCTGAGGCCCAGAAAGG + Intronic
1134320471 16:13158123-13158145 TTTACAGATGAGGCACAGAGAGG - Intronic
1134362942 16:13549732-13549754 ATTAGAGCTGAGGCCAGGTGTGG + Intergenic
1135257257 16:20951007-20951029 TGTAGAGATGTGGCCCAGACTGG + Intronic
1135397290 16:22140900-22140922 TTAAGAGATGTGGCCAGGCGTGG - Intronic
1135946997 16:26873882-26873904 CTCAGAGGAGAGGCCCGGAGAGG + Intergenic
1136018751 16:27426142-27426164 TTTACAGATGAGGCCCAGAAAGG + Intronic
1136123057 16:28153398-28153420 TTTGCAGATGAAGCCCAGAGAGG + Intronic
1137267644 16:46882362-46882384 TTTATAGATGAGGCTCAGAGAGG - Intergenic
1137613480 16:49834390-49834412 TGCACAGATGAGGCCCAGAGAGG + Intronic
1138148919 16:54637344-54637366 TTTAGGAAGGAGGCCCAGAGAGG + Intergenic
1139436864 16:66941508-66941530 TTTCAAGATGATCCCCGGAGTGG + Exonic
1140194568 16:72845855-72845877 TTCACAGATGAGGCTCAGAGAGG + Intronic
1141400767 16:83745025-83745047 TTTACAGATGAGGAACTGAGAGG - Intronic
1142053112 16:87973468-87973490 TCTAGAGCTGAGGCCGGGCGCGG + Intronic
1142757460 17:2024609-2024631 CCTAGAGATCCGGCCCGGAGGGG - Intronic
1143251389 17:5525731-5525753 TTTACAGATGATGCACAGAGAGG - Intronic
1143397255 17:6610791-6610813 TTTAGACCTAAGGCCCAGAGAGG - Intronic
1143885295 17:10060613-10060635 TTTAGAAATGAGCCCCAGAAAGG - Intronic
1144401410 17:14906493-14906515 TTGAGAGATGTGGCCCAGCGCGG + Intergenic
1144838413 17:18170837-18170859 TTTACAGATAAGGCCCAGAGAGG + Intronic
1144871484 17:18374632-18374654 TTTAAAGATTAGGCCGGGTGCGG + Intergenic
1145354446 17:22128585-22128607 TTTAGAGATGAGACCCCCACAGG + Intergenic
1146185911 17:30724092-30724114 TCTAGAGAAGAGGCCCTGTGAGG + Intergenic
1146604893 17:34249763-34249785 TTGACAGAAGAGGCCCAGAGAGG + Intergenic
1146686087 17:34842442-34842464 TTTACAGATAAGGCTCAGAGAGG - Intergenic
1146815688 17:35940198-35940220 TTTACAAATGAGGCCCAGAAAGG - Intronic
1147238159 17:39072688-39072710 GTGAGAGATGAGGCTGGGAGTGG + Intronic
1147352343 17:39859677-39859699 TATAAGGATGAGGCCAGGAGTGG - Intronic
1147363479 17:39945512-39945534 TACAGAGCTGAGGCCTGGAGTGG + Intergenic
1147363910 17:39947922-39947944 TACAGAGCTGAGGCCTGGAGTGG + Intergenic
1148020915 17:44552941-44552963 TTAAGAGATGAGGCCGGGCATGG + Intergenic
1149168175 17:53779123-53779145 TTAAGAGATGGGTCCCTGAGAGG - Intergenic
1149710278 17:58735485-58735507 TATAGAAATGAGGCCAGGTGTGG - Exonic
1150288304 17:63966399-63966421 ATTAGAGATGAGGACCTGGGGGG - Intronic
1150438574 17:65173210-65173232 AATAGAGATGAGGCCAGGCGCGG - Intronic
1151763981 17:76122647-76122669 TTTGGAGAGGAGCCTCGGAGGGG + Intergenic
1152615384 17:81335552-81335574 ATTAAAGATGAGGCACAGAGAGG - Intergenic
1153189388 18:2520983-2521005 TTTACAAATGAGGCCCGGAGAGG - Intergenic
1155082690 18:22426492-22426514 TTTAGAGATGAGGTAAAGAGAGG - Intergenic
1157599602 18:48885868-48885890 TTCACAGATGAGGCCCAGGGAGG - Intergenic
1157692793 18:49697726-49697748 TTTACAGATGAGGTTCTGAGAGG + Intergenic
1157733064 18:50021428-50021450 TTGAGAGCTGAGGCCCTGAGAGG - Intronic
1158058803 18:53313534-53313556 CTTAGAAATGCGGCCGGGAGCGG - Intronic
1158421790 18:57301361-57301383 TTTACAGATGAGGTACAGAGAGG - Intergenic
1160078671 18:75702843-75702865 TTTAGTGATGCTGCCCAGAGTGG + Intergenic
1160696375 19:486622-486644 AATAGAGATGGGGCCGGGAGCGG + Intergenic
1161249042 19:3270724-3270746 TTTAGAGTGGAGGCCTGGAGAGG + Intronic
1161456662 19:4373087-4373109 CTCAGGGATGAGGCCAGGAGGGG + Intronic
1161686703 19:5706316-5706338 TGTAGAGATGGGGCCAGGCGCGG + Intronic
1161782700 19:6303914-6303936 TTTATAGATGTGGCTCAGAGAGG - Intergenic
1162972865 19:14191637-14191659 TCTAGAGAAGAGGCCCTGTGAGG - Intronic
1163307064 19:16487186-16487208 TGTAGAGATGGGGCCAGGCGTGG + Intronic
1164598580 19:29546436-29546458 TTCATAGGTGAGGCCCAGAGAGG - Intronic
1165043118 19:33082946-33082968 AATAGAGATGAGGCCGGGCGTGG + Intronic
1165354372 19:35294493-35294515 TTTATAGCTGAGGTCCAGAGAGG - Intronic
1165475172 19:36026325-36026347 TTAAGAGATGAGCCCCGAGGTGG - Intronic
1165597490 19:37022757-37022779 TTTACATATGATGCCCAGAGGGG + Intronic
1165777301 19:38412410-38412432 TCTAGATAGGAGGCCAGGAGTGG - Intronic
1166564680 19:43756509-43756531 AGTAGGGATGAGGCCTGGAGGGG - Intergenic
1166658736 19:44630941-44630963 TTTACAGATGAGCCACTGAGGGG - Intronic
1167278902 19:48554831-48554853 GTCAGAGATGAGGCCCAGAGAGG + Intronic
1167279403 19:48558152-48558174 GTAAGAGGTGAGGCCCAGAGAGG + Intronic
1168351572 19:55679169-55679191 TTCATAGATGGGGCCCAGAGCGG - Intronic
925901554 2:8512769-8512791 TTTGGAGATGAGACCCGTAAGGG - Intergenic
927663060 2:25009057-25009079 TTTATATATGAGGCCGGGCGTGG + Intergenic
928104598 2:28460421-28460443 TTTAGTTATCAGGCCCAGAGAGG - Intronic
928203860 2:29270319-29270341 TTAACAGATGAGGTCCAGAGAGG - Intronic
929533299 2:42765305-42765327 TTTACAGATCAGGCTCAGAGAGG - Intergenic
930035378 2:47082091-47082113 TCTTGAGATGAGGCCAGGCGAGG + Intronic
932501347 2:72185521-72185543 TTTAGAGATGAGAGAAGGAGTGG + Intronic
933379458 2:81524338-81524360 TTTAGAGATGAGGTGGGTAGTGG - Intergenic
933587952 2:84200508-84200530 TTTAGAGAGGTGGGCCTGAGAGG + Intergenic
933676190 2:85059922-85059944 TATAGAAATGAGGCCAGGTGTGG - Intergenic
935413233 2:102787850-102787872 TTTACAGATGAGGCTCAGAGAGG - Intronic
936155019 2:110041657-110041679 TGTAAAGATGAGGCTCAGAGAGG + Intergenic
936189663 2:110329757-110329779 TGTAAAGATGAGGCTCAGAGAGG - Intergenic
938296091 2:130180559-130180581 TTAAGAATTGAGGCCGGGAGCGG - Intronic
938307965 2:130267501-130267523 ATTGGAGATGAGGCACAGAGTGG + Intergenic
938447366 2:131389338-131389360 ATTGGAGATGAGGCACAGAGTGG - Intergenic
938730440 2:134142983-134143005 TTTAGAGATACAGGCCGGAGGGG + Intronic
939360944 2:141171765-141171787 TTTAAAGATGAGGCTTGGAGAGG - Intronic
939485137 2:142801937-142801959 TTTAGAGGTGGGGCCTGGTGGGG - Intergenic
941948223 2:171123491-171123513 TTAACAGATGAGGCCAGGCGTGG - Intronic
944364392 2:198899906-198899928 TTTATATATGAGGCCAGTAGTGG + Intergenic
944498034 2:200328481-200328503 TTTAAAGATTAAGCCCAGAGAGG + Intronic
944823893 2:203460824-203460846 TATAAAGATGAGGCCAGGCGTGG + Intronic
946452313 2:219791297-219791319 TTTACAGATGAGGCACAGACAGG - Intergenic
946894817 2:224312719-224312741 TGCAGAGCTGAGGCCCAGAGAGG - Intergenic
948212118 2:236202239-236202261 TTTAAAAATGAGGCCAGGTGTGG - Intronic
1168840599 20:907644-907666 TTTACAGACGAGGCACAGAGAGG + Intronic
1169242258 20:3993575-3993597 TTCAGATATGTGGCCAGGAGTGG - Intronic
1170205613 20:13795000-13795022 TTTTGCTATGAGGCCAGGAGCGG + Intronic
1170477599 20:16731016-16731038 TTTACTGATGAGGACCTGAGAGG + Intronic
1170791227 20:19511142-19511164 TGGAGAGATGAGGCAGGGAGGGG - Intronic
1172014438 20:31864556-31864578 TTTACAGGTGAGGCCCAGAGCGG + Intronic
1172321109 20:33995465-33995487 TTTTCAGATAAGGCCCAGAGTGG + Intronic
1172645072 20:36463897-36463919 TGAAGAGATGAGGCCCAGAAGGG + Intronic
1173029245 20:39339474-39339496 TTTATAGATGAGGCTTAGAGAGG + Intergenic
1173096865 20:40041634-40041656 TTTAGAGACCAGGCACGCAGTGG - Intergenic
1173591004 20:44224814-44224836 TTTGCAGATGAGCCCCAGAGAGG + Intergenic
1173620751 20:44434199-44434221 TTTACAGATGAGGCTCGGAGTGG - Intergenic
1173736996 20:45369124-45369146 TTTAGAGTTGAGTTCCAGAGAGG + Exonic
1173993814 20:47322731-47322753 TTTATAGGTGAGGCTCAGAGAGG + Intronic
1175074569 20:56361684-56361706 ATTAGAGATGAGGCCGGGCGCGG + Intronic
1177144422 21:17392142-17392164 TTCAGAGATGAGTCACGCAGTGG - Intergenic
1177950372 21:27528328-27528350 TTTATAGATGAGGCACTGAAGGG - Intergenic
1178835948 21:36097630-36097652 TTTAAAGGGGAGGCCGGGAGTGG - Intergenic
1179528901 21:42004304-42004326 TTAAGATATGAGGCCGGGCGCGG - Intronic
1180754914 22:18154729-18154751 TATAGAGATGAGGCCTGGCATGG - Intronic
1180795050 22:18599267-18599289 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1181226688 22:21396049-21396071 AATAGAGATGAGGCCGGGTGTGG - Intergenic
1181251961 22:21538803-21538825 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1182676889 22:32046145-32046167 TTTACAGATGAGGATCGGAGAGG + Intronic
1183028743 22:35086028-35086050 CTTACAGATGAGGTCCAGAGAGG - Exonic
1183329679 22:37212536-37212558 TTAAGGGAGGAGGCCCGGAGAGG + Intergenic
1183340685 22:37279320-37279342 ATTAAAAATGAGGCTCGGAGGGG + Intergenic
1183538372 22:38416001-38416023 GTTACAGATGAGGCTCAGAGAGG + Intergenic
1183670675 22:39270609-39270631 TGTGGAGATGGGGACCGGAGAGG + Intergenic
1184281029 22:43437656-43437678 TTTTAAAATGAGGCCCAGAGGGG - Intronic
1184935868 22:47720021-47720043 TCCAGAGATGAGGCCGGGCGCGG + Intergenic
950127495 3:10518878-10518900 TTTACAGATGAGGTCCAGGGAGG - Intronic
950172511 3:10848864-10848886 TTTACAAATAAGGCCCAGAGAGG + Intronic
950196596 3:11013701-11013723 TTTATAGATGAGGGTCAGAGAGG + Intronic
950330305 3:12150941-12150963 TTTACATATGGGGCCCAGAGAGG - Intronic
950556116 3:13696989-13697011 TTTGGAGATGAGGCCCAGATGGG - Intergenic
951216823 3:20032995-20033017 TTTAAAAAGGAGGCCAGGAGTGG + Intergenic
953458265 3:43061168-43061190 TTTACAGATGAGGCACAGAGGGG + Intergenic
953791998 3:45954666-45954688 TTTGGAGATGAGGCCTGTAGAGG + Intronic
954606984 3:51919696-51919718 TATACAGATGAGGCCGGGTGCGG + Intergenic
954671430 3:52293269-52293291 TATAGAGCAGAGGCCCTGAGTGG - Exonic
955437841 3:58922416-58922438 GTTAGAGATGGGGCCTGGTGGGG + Intronic
955577903 3:60386613-60386635 TTTAGAGAAGAGGCAAGAAGTGG - Intronic
956381895 3:68673035-68673057 TGTAGAGAAGAGGCCAGGAGAGG + Intergenic
958777929 3:98507693-98507715 TTAAGAGATGAGGCCAGGCGTGG - Intronic
960502784 3:118457215-118457237 GTTAGAAATGAGGCCTGGTGGGG - Intergenic
962771961 3:138620201-138620223 TTTACAGATGAGGCTTAGAGAGG - Intronic
963374741 3:144449723-144449745 GTTAGAGATGAGGCCGGGCGCGG + Intergenic
964711447 3:159675839-159675861 TTTATATATGAGGCCAGGCGTGG + Intronic
966297935 3:178445343-178445365 TTTACATATCAGGCCCTGAGAGG - Intronic
966513235 3:180787328-180787350 GTTAGAGGTGAGGCCTGGTGGGG + Intronic
966639729 3:182176507-182176529 TTCACAGATGAGGCCCAGTGAGG + Intergenic
966663092 3:182437028-182437050 TATAGAGATGAGATCCAGAGAGG + Intergenic
966715772 3:183011660-183011682 TTTACAGATAAAGCTCGGAGAGG + Intergenic
966760715 3:183416817-183416839 TTTAGAGATCAGGCTGGGAGTGG + Intronic
966780865 3:183583090-183583112 TTGGCAGATGAGGCCCAGAGAGG + Intergenic
967953682 3:194860645-194860667 GTAAAAAATGAGGCCCGGAGAGG + Intergenic
968465594 4:748624-748646 TTCAGAGAAGGGGTCCGGAGGGG + Intronic
969473956 4:7410455-7410477 TTTACAGAGGAGACCCAGAGAGG - Intronic
969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG + Intronic
971097904 4:23428808-23428830 TTTAAAAATGAGGACCAGAGTGG - Intergenic
972214472 4:36879782-36879804 AGTAGAGATGAGGCCTGCAGAGG - Intergenic
972565019 4:40261854-40261876 TTAAGTGATCAGGCCCAGAGAGG - Intergenic
973160523 4:47010381-47010403 TTAAGAGATGAGAACCTGAGGGG + Intronic
974436992 4:61869306-61869328 TTTAAAAATGAGGCCGGGCGCGG + Intronic
977547584 4:98402360-98402382 TTTAGAGATGAGGCCGGGCATGG - Intronic
977612270 4:99048287-99048309 CTTACAGATGAGGCACAGAGAGG - Intronic
978963765 4:114716008-114716030 TTTAGAAATGTGGCCAGGCGTGG - Intergenic
979181180 4:117729463-117729485 TTTAGACATGATGCTCTGAGAGG + Intergenic
983517149 4:168669873-168669895 TTTATAACTGAGGCCTGGAGAGG + Intronic
984591573 4:181623227-181623249 TTTACAGCTGAGGCACAGAGAGG - Intergenic
984615202 4:181889156-181889178 GTTAGAGGTGGGGCCCGGTGGGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986692463 5:10325044-10325066 TTTGGAGATAGGGCCCTGAGGGG - Intergenic
989125386 5:38047652-38047674 TTTAGAGCTGAGGTTCAGAGAGG - Intergenic
989361785 5:40609767-40609789 TTTATAGATGAGGAACTGAGTGG - Intergenic
989961063 5:50415629-50415651 TTTAGAGATGAGGCAAAGAGAGG + Intronic
990508317 5:56466742-56466764 TTTATAGATGTGGCACAGAGAGG + Intronic
990574706 5:57113197-57113219 TTTAGAGATGAGGGTAGTAGAGG + Intergenic
992665462 5:79004153-79004175 TTTAAAGATGAGGCTTTGAGGGG - Intronic
993358725 5:86946728-86946750 TTTGGAGATGAGGCCTTTAGAGG - Intergenic
994287448 5:97986553-97986575 TTTCTAGATGAGGCTCAGAGAGG + Intergenic
995282417 5:110350943-110350965 TGTAGATATGAGGCCTGGACTGG - Intronic
996331150 5:122330409-122330431 TTAAGAAATGAGGCCGGGCGCGG - Intronic
997199145 5:131999245-131999267 GTTTGAGATGAGGCCCAGAGGGG - Intronic
997569581 5:134915891-134915913 TGTAGAGCTCAGGCCAGGAGAGG - Intronic
998659577 5:144221012-144221034 TTAAGAGATGTGGACAGGAGTGG + Intronic
998878921 5:146627709-146627731 TTTATAGATGAGGCACAGAGAGG - Intronic
999064172 5:148667715-148667737 TTTAGAGATGAAGTCTGTAGAGG - Intronic
1000435329 5:161200866-161200888 ATTAGACATTAGGCCCGGGGTGG + Intergenic
1000848607 5:166312045-166312067 ATTACAGATGAGGCTCAGAGAGG + Intergenic
1001042092 5:168343531-168343553 TTAAGAGTTGAGGCCGGGCGTGG + Intronic
1001593391 5:172881749-172881771 TTTACAGATGAGGCTCAGAGAGG - Intronic
1001638921 5:173231860-173231882 TTAGAAGCTGAGGCCCGGAGAGG - Intergenic
1002539611 5:179897613-179897635 TTTAGAATTGAGGCCAGGTGTGG - Intronic
1004434540 6:15577722-15577744 TTTAGGGGTGAGGCCAGGATTGG + Intronic
1005427723 6:25720933-25720955 TTTAGGGAAGAGGCCGGGCGCGG + Intergenic
1005510509 6:26508178-26508200 TTTAGTGATGAGGACAGGAAGGG + Intronic
1005673551 6:28131304-28131326 ATTAGAGATGTGGCCAGGTGTGG - Intergenic
1007102159 6:39256614-39256636 TTTATAGATGAGGCTCAAAGCGG + Intergenic
1010831329 6:80534208-80534230 TTAAGAGGTGAGGCCCTGGGAGG + Intergenic
1012327402 6:97938921-97938943 TTAAGAGATGAGGCCAGGCGCGG - Intergenic
1012349146 6:98229923-98229945 TGTAAAGATGAGGCCCAGAGAGG - Intergenic
1016505842 6:144778074-144778096 TTTAGAGATAGGGCCAGAAGTGG + Intronic
1017111581 6:150937732-150937754 TTTAGAGATGCGGCTCCGAGAGG - Intronic
1017453618 6:154577692-154577714 TTTAAAGATGAGGCTTAGAGGGG - Intergenic
1017462842 6:154667465-154667487 TTTATATATGAGGCCAGCAGAGG - Intergenic
1017501669 6:155031430-155031452 TGAAGAGATGAGGCTGGGAGTGG + Intronic
1018504842 6:164454818-164454840 TTTAGAAATCAGGCCAGGCGTGG + Intergenic
1018854487 6:167665932-167665954 TTTACAGCTGAGGCACAGAGAGG - Intergenic
1020404469 7:7816449-7816471 TGTAGAGATGAGGCCGGGAGAGG + Intronic
1021651427 7:22837354-22837376 TTAAAATATGAGGCCCGGGGAGG + Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1025626061 7:63223642-63223664 TTTAGACATGAGGTTTGGAGGGG - Intergenic
1025856623 7:65285945-65285967 TTTACAAAAGAGGCCTGGAGAGG - Intergenic
1026382849 7:69816724-69816746 TGTAGATATGAGGGCCAGAGAGG + Intronic
1026841723 7:73673022-73673044 ATTAGGGATGAGGCCAGGAGCGG + Intergenic
1026970643 7:74465483-74465505 TTTTCAGATGAGGCTCAGAGAGG - Intronic
1027251996 7:76404638-76404660 TTTAAAAATGAGGCCGGGTGTGG + Intronic
1027377556 7:77567878-77567900 TTTATAGATGAGACACAGAGAGG + Intronic
1027704637 7:81513714-81513736 TTGAGAGATGAGACAGGGAGAGG - Intergenic
1029545736 7:101209679-101209701 ATAAGAAATGAGGCCAGGAGTGG - Intronic
1030421885 7:109317431-109317453 TTCTGAGATGAGGCCGGGTGTGG + Intergenic
1030597112 7:111553173-111553195 TTTACATATGAGGCTCAGAGAGG + Intronic
1030890893 7:114997552-114997574 TGTAGAGATGAGGTCCAGACTGG - Intronic
1032427386 7:131832806-131832828 TTTAGAAATCAGCCCAGGAGAGG + Intergenic
1033216876 7:139499824-139499846 TTCAGAGATGGGGCCGGGTGCGG - Intergenic
1035476849 7:159149861-159149883 TTGAGAGATGAGGCCCGGGTGGG + Intergenic
1036219285 8:6907780-6907802 TTTGCAGAGGAGGCCCAGAGAGG + Intergenic
1036568746 8:9961067-9961089 TTTGGAGATGTGGGCCAGAGAGG + Intergenic
1037805405 8:22055795-22055817 TTGAGGGAAGAGGCCAGGAGGGG - Intronic
1038489049 8:27956567-27956589 TTTAAAAATGAGGTCCAGAGAGG + Intronic
1038687652 8:29733241-29733263 TTTAGAGATAAGGACCTGAAAGG + Intergenic
1039452899 8:37689904-37689926 TTTGTAGGTGAGGCCCAGAGAGG - Intergenic
1039468413 8:37799084-37799106 TTCAGAGCTGAGGCCGGGTGCGG + Intronic
1040491137 8:47923468-47923490 TTGACAGAAGAGGCCCAGAGTGG + Intronic
1044357389 8:91239078-91239100 TATATAGATGAGGCCGGGTGTGG + Intronic
1045121427 8:99041474-99041496 TTTACAGATGAGGCCCCTAGAGG - Intronic
1046348525 8:112971009-112971031 TTGAAAGATGAGGCCAGGCGTGG - Intronic
1047171713 8:122500215-122500237 TTTATAGATGAGGCTTGGAGAGG - Intergenic
1047961226 8:130013415-130013437 TTTAGAGATGAGGAAAAGAGGGG + Intronic
1047977780 8:130148322-130148344 TTTATAGATGAAGCTCAGAGAGG - Intronic
1048505447 8:135016633-135016655 TTTAGAGATGAGTCTCAAAGGGG - Intergenic
1049147450 8:141011745-141011767 TTAAGAGATGAGGCCCAGTGCGG + Intergenic
1049207882 8:141371838-141371860 TGTGGAGATGAAGGCCGGAGAGG + Intergenic
1049273762 8:141709524-141709546 GGTAGAAATGAGGCCCAGAGCGG - Intergenic
1050213126 9:3287483-3287505 TTTTCAGATGAGTCCCAGAGAGG - Intronic
1051140378 9:13972407-13972429 TTTACAGATAAGGCCTGGAGAGG - Intergenic
1051286736 9:15504976-15504998 TTTTGAGATGAGGTCTGCAGTGG + Intronic
1051600311 9:18865838-18865860 TTAATAGCTGAGGCCTGGAGAGG + Intronic
1052842781 9:33307514-33307536 TTTACAGATGAGGCTCAGAAAGG + Intronic
1055998702 9:82191251-82191273 TTTGGAGCTGAGGCTAGGAGAGG + Intergenic
1057361348 9:94375963-94375985 TTTACAGAGGAGGCACTGAGGGG - Intronic
1057662013 9:97012206-97012228 TTTACAGAGGAGGCACTGAGGGG + Intronic
1057706274 9:97397233-97397255 ATGAGAAATGAGGCCCAGAGTGG - Intergenic
1057910883 9:99019830-99019852 TTTGCAGATGAGGCCCAGAAAGG + Intronic
1058541941 9:106020719-106020741 TTTACAGATGAGGCCCAGAGAGG - Intergenic
1059467847 9:114480394-114480416 TTTGGAGATGAGGCCTTTAGGGG + Intronic
1059518224 9:114915360-114915382 ATTACAGATGAGGCTCAGAGAGG + Intronic
1060397014 9:123323344-123323366 TTTACAGATGAGGCACAGAGAGG - Intergenic
1060548937 9:124476209-124476231 ATTAGTAATGAGGCCCAGAGAGG - Intronic
1061098847 9:128476927-128476949 TTTAAAGATAAGGCCGGGCGCGG - Intronic
1061120536 9:128639600-128639622 TTTATAGATGAGGCTGAGAGAGG - Intronic
1061414535 9:130439167-130439189 GTTAGAGCTGAGGCCAGGCGCGG + Intergenic
1185451358 X:282046-282068 CTTAGAAATGAGACCTGGAGGGG - Intronic
1186020843 X:5253299-5253321 TTTTGAGAAGAGGCCCACAGAGG + Intergenic
1186413025 X:9360400-9360422 TTTGAAGATGAGGCCTGGACAGG - Intergenic
1187420594 X:19130418-19130440 GTTAGAAATGAGGCCAGGCGAGG - Intergenic
1187676984 X:21726087-21726109 TTTATAGATGTGGCTCAGAGTGG + Intronic
1188317734 X:28695284-28695306 TTTACAGAGGAGGCACTGAGAGG + Intronic
1189311086 X:40018087-40018109 TTTCGAGATGTGGCCCGGGCTGG - Intergenic
1189497477 X:41522108-41522130 TTTAGAGAAGAGGAGAGGAGGGG - Intronic
1190402126 X:50047817-50047839 TTTGGAGATGAAGACCGCAGAGG + Intronic
1190555671 X:51632684-51632706 TTTAGAGATGAGGACTTTAGGGG - Intergenic
1192181835 X:68920988-68921010 GCTACAGATGAGGCCCAGAGAGG - Intergenic
1192558509 X:72109318-72109340 TTTATAGATGAGGCACTGGGAGG + Intergenic
1193670956 X:84385501-84385523 ATCAGAGATGAGGCCGGGCGCGG - Intronic
1194753880 X:97714483-97714505 TTTACAGATGAGGCACAGAAAGG + Intergenic
1195109115 X:101628005-101628027 TTTATATATGAGGCCAGGAAAGG + Intergenic
1195689269 X:107610459-107610481 TTTAGAGGAGAGGCCCAAAGAGG - Intergenic
1195937373 X:110138541-110138563 TTTAGAGATGAGGGACATAGGGG + Intronic
1196088718 X:111715425-111715447 TTTAAAAATGAGGCCGGGTGTGG + Intronic
1198805265 X:140487975-140487997 TTTATACCTGAGGCCCAGAGGGG + Intergenic