ID: 969842206

View in Genome Browser
Species Human (GRCh38)
Location 4:9890953-9890975
Sequence CCGAATCTTCCTTGCTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969842202_969842206 6 Left 969842202 4:9890924-9890946 CCTACAGCATTAATAACGAGCAC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 969842206 4:9890953-9890975 CCGAATCTTCCTTGCTATGGTGG 0: 1
1: 0
2: 0
3: 2
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969842206 Original CRISPR CCGAATCTTCCTTGCTATGG TGG Intronic
900898281 1:5498880-5498902 CTGAGTCTTCCTTGTTTTGGGGG - Intergenic
904503082 1:30928838-30928860 CCAATTTTTCCTTGCTATGTTGG - Intergenic
907456275 1:54578136-54578158 TGGCATCTTCCTTGGTATGGGGG - Intronic
910798620 1:91123088-91123110 CCAAATATTCCTGGCTATGCTGG - Intergenic
912322261 1:108725137-108725159 AAGAATTTTCCATGCTATGGAGG + Intronic
917521860 1:175754308-175754330 CCCCATCTTCCTTGCTCTGCGGG + Intergenic
917812311 1:178671446-178671468 CCAAATCATTGTTGCTATGGGGG - Intergenic
919466066 1:197922431-197922453 CACATTCTTCCTTGCTTTGGGGG + Intronic
1070152926 10:73816254-73816276 TAGAATCTTCCTGACTATGGAGG - Intronic
1070899256 10:80013751-80013773 TGGCATCTTCCTTGGTATGGGGG + Intergenic
1071393114 10:85195335-85195357 CCGCATCTTCCCTGTTAAGGTGG - Intergenic
1077917835 11:6622641-6622663 CAGACTCTTCCCAGCTATGGTGG - Exonic
1079136384 11:17778118-17778140 CAGAATCTTCCTGGCCAGGGTGG - Intronic
1079509211 11:21190932-21190954 CAAAATCTTCCCTGCTAGGGAGG - Intronic
1079741051 11:24060688-24060710 CCAAATATTCCTTACCATGGAGG + Intergenic
1080064610 11:27996571-27996593 CCCACTGTTCTTTGCTATGGAGG - Intergenic
1081852685 11:46284835-46284857 CTGAATTTTCCTTGCTCTAGAGG - Intronic
1084420268 11:69057198-69057220 CCCAAGCTGCCTTGCTGTGGCGG + Intronic
1086669057 11:89524638-89524660 CTGTATCTTCCTTGTAATGGTGG - Intergenic
1088285371 11:108182204-108182226 TGGCATCTTCCTTGGTATGGGGG + Intronic
1101773963 12:107776916-107776938 CCGAATTATCCTTTCCATGGAGG + Intergenic
1122675524 14:103409788-103409810 CATAGTCTTCCTGGCTATGGTGG + Intronic
1126476738 15:49073225-49073247 CAGAATCGTCTTGGCTATGGGGG - Intergenic
1129065452 15:72900251-72900273 TCGAATCTTCCTTGGGATGGTGG + Intergenic
1132808983 16:1788665-1788687 CAGAATCTTCTGGGCTATGGAGG - Exonic
1136119328 16:28120713-28120735 GAGAATCTTACTTACTATGGTGG - Intronic
1138245531 16:55464242-55464264 CCAAATCTTGCTTGCTCCGGGGG + Intronic
1138775448 16:59717544-59717566 TAGAAACATCCTTGCTATGGAGG + Intronic
1145007502 17:19345875-19345897 CAGAATCTTCCCAGATATGGAGG - Intronic
1149379310 17:56077379-56077401 CTGAATTTTCCTTGTGATGGTGG - Intergenic
1149754009 17:59172793-59172815 CTGAGTCTTCCCTGCCATGGTGG + Intronic
1151792273 17:76314809-76314831 CAGAATCTTCCATGCTCTGCTGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
927011546 2:18909433-18909455 CCAAATCTTCCATTCTATGATGG + Intergenic
928744448 2:34395194-34395216 CCAAATCTTACTTGCTATTAAGG - Intergenic
933719898 2:85391173-85391195 CAGAATTCTCCTTGCTCTGGAGG - Exonic
940003488 2:148990271-148990293 CAGAATCTTCTTTTCTAAGGTGG + Intronic
942054475 2:172169514-172169536 CCTAAACTTCCTTGCTGTAGTGG + Intergenic
944261066 2:197677715-197677737 CCGTATCCTCTTTGGTATGGTGG + Intergenic
945254283 2:207790937-207790959 TAGAACCTTCCTTGCCATGGTGG - Intergenic
1175744286 20:61443261-61443283 CAGAGTCTTCCTTGTTATGCCGG + Intronic
1177999996 21:28150227-28150249 ACGAAACCTCATTGCTATGGAGG + Intergenic
1179123194 21:38567796-38567818 CCGAATCTGCCTTGCGAGGAAGG - Intronic
952517903 3:34124409-34124431 CAGCACCTTCCTAGCTATGGAGG - Intergenic
959340267 3:105120644-105120666 CCAAACCTTTCTTGTTATGGAGG - Intergenic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
961418490 3:126780565-126780587 CTGATTCTCCCTTGCTTTGGAGG + Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
969842206 4:9890953-9890975 CCGAATCTTCCTTGCTATGGTGG + Intronic
977375569 4:96198350-96198372 CAGAATCTTCCTTAGAATGGGGG + Intergenic
978391134 4:108226542-108226564 CCAAATCTCCCATGGTATGGAGG - Intergenic
981081368 4:140642329-140642351 CCCTATCTTCCTGGCTTTGGCGG + Intronic
989774040 5:45181444-45181466 CTGAATCTTACTTTCTATGGTGG - Intergenic
990143032 5:52727716-52727738 CCGAAGCTTCATTGATATGAAGG - Intergenic
998846005 5:146310509-146310531 CCACATCTTCATTGCTTTGGGGG + Intronic
1000377678 5:160598584-160598606 CCGTTTCTTACTTGCTATTGAGG - Intronic
1004523325 6:16382636-16382658 CAGCATCTTCATTGTTATGGAGG - Intronic
1007016356 6:38471336-38471358 CCTCATCTTCCTTGCTTTGATGG - Intronic
1016831494 6:148438207-148438229 CCAAATCTTCCTTCCTATTCAGG - Intronic
1022819976 7:33950203-33950225 GCGAATGTTCCTGGCCATGGTGG + Intronic
1046024324 8:108703915-108703937 CCCAATCTTCATTGCTTTGAAGG + Intronic
1047504168 8:125465739-125465761 CTGAATTTTCCTTGCTGGGGTGG + Intergenic
1048045359 8:130767673-130767695 CAGGGTCTTCCTTGCTATGTTGG + Intergenic
1048113614 8:131495183-131495205 CCTCTTCTTCCTTGCTATTGTGG - Intergenic
1048225061 8:132577174-132577196 CCAAGTCTTCCTTCTTATGGGGG + Intronic
1057987969 9:99736744-99736766 GAGAATCTTCCCTGCTATAGGGG + Intergenic
1186344428 X:8677162-8677184 CCGATGGTTCCTTGCGATGGTGG + Intronic
1186978865 X:14937786-14937808 CCGAACATTCTTTGCTGTGGAGG - Intergenic
1187387064 X:18858611-18858633 TATAATATTCCTTGCTATGGAGG + Intergenic
1187509854 X:19908012-19908034 ACCAATCTTCATGGCTATGGTGG - Intergenic
1191274639 X:58527780-58527802 CAGAAACTTCTTTGTTATGGGGG + Intergenic
1192571835 X:72212589-72212611 CTTGATTTTCCTTGCTATGGAGG + Intronic