ID: 969842595

View in Genome Browser
Species Human (GRCh38)
Location 4:9893388-9893410
Sequence TCTCATTTGCAGGGGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969842595 Original CRISPR TCTCATTTGCAGGGGGAGGG CGG Intronic
900194939 1:1371334-1371356 TCTCACAGGCAGGGGCAGGGTGG + Intergenic
900372573 1:2338630-2338652 TGCCATTTGCAGGGGCAAGGTGG + Intronic
901012652 1:6210209-6210231 TCGTATTGGCTGGGGGAGGGGGG - Exonic
902413765 1:16227060-16227082 TCTCATGTGGAGGGGTGGGGCGG - Intergenic
903269163 1:22177053-22177075 CCTCATTGGAAGGGGGTGGGTGG + Intergenic
903333322 1:22608701-22608723 TCACTATTGCTGGGGGAGGGGGG + Intergenic
903655662 1:24947602-24947624 TCCCATCTGCTGGGGCAGGGTGG - Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904602847 1:31683359-31683381 TCTGACTTGCAGGGGGAGCCTGG - Exonic
904642961 1:31944485-31944507 CCTCTTTTGCAGGGGCGGGGCGG + Intronic
906652375 1:47521827-47521849 TATTATTTGCAGGGTGAGGAGGG + Intergenic
907529909 1:55084715-55084737 TTCCATTTACGGGGGGAGGGGGG + Intronic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
908716118 1:67071151-67071173 ACTTTTTTGCGGGGGGAGGGGGG - Intergenic
909656321 1:78037459-78037481 TTCCATTTGCTGGGGTAGGGGGG - Intronic
909994318 1:82260417-82260439 GCTGACTTGGAGGGGGAGGGTGG + Intergenic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
910635773 1:89405668-89405690 TCCCCTTGGCTGGGGGAGGGAGG + Intergenic
910950797 1:92645987-92646009 TCTGGTTTGCAGGGGGAGCCTGG - Intronic
911102688 1:94106745-94106767 TCTCACTTGGATGGGGAGAGAGG + Intronic
913506921 1:119525647-119525669 TGTCGTTTGGTGGGGGAGGGGGG + Intergenic
915247959 1:154569382-154569404 TCCCATTTGCCTGGGGAGGGTGG + Intronic
915565470 1:156710477-156710499 TCTCAGTGCCAGGGGGTGGGGGG - Intergenic
915900243 1:159841506-159841528 TGTCAGTTTCAGGGGGTGGGAGG - Intronic
915971457 1:160358132-160358154 GATCAACTGCAGGGGGAGGGAGG - Exonic
916011910 1:160713925-160713947 TCTCTTTTTTGGGGGGAGGGGGG + Intergenic
918256635 1:182754463-182754485 ACCCATTTGCGGGTGGAGGGCGG + Intergenic
919982045 1:202647830-202647852 AGTGATTTGGAGGGGGAGGGAGG - Intronic
920061657 1:203230972-203230994 TATCCTTTGCGGGGGGTGGGAGG + Intronic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
922892010 1:229068721-229068743 TCTCAGTTGCTGGGGTGGGGTGG + Intergenic
923213049 1:231823280-231823302 TTTTATTGGCAGGGAGAGGGAGG + Intronic
1062891389 10:1063382-1063404 TCTGATTAGCAGGGTGAGGGTGG - Intronic
1062891401 10:1063463-1063485 TCTGATTAGCAGGGTGAGGGTGG - Intronic
1062960455 10:1569454-1569476 TCTCATTCCCAGAGGGAGCGTGG + Intronic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1063721635 10:8588307-8588329 TCTCATTGGCAGGGGCTGGGTGG + Intergenic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1064438779 10:15334206-15334228 TCTCATTTGAAAGGGGAATGGGG - Intronic
1065471441 10:26086023-26086045 ACTCATTTGCAGGTAGGGGGAGG + Intronic
1066483507 10:35821600-35821622 TCTTCTCAGCAGGGGGAGGGAGG - Intergenic
1067566544 10:47342785-47342807 GCTCATTTGTTGGGGAAGGGAGG - Intergenic
1067767053 10:49094771-49094793 TCTCAGTGGCAGGGGGTGGGGGG + Intronic
1067894283 10:50162513-50162535 TCTCAGCTCCAGGAGGAGGGAGG - Intergenic
1067954559 10:50777748-50777770 TCTCAGCTCCAGGAGGAGGGAGG + Intronic
1068337707 10:55659065-55659087 TCTTATTTGAAGGGAGAGGAGGG - Intergenic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1070989182 10:80716298-80716320 GCTCATGAACAGGGGGAGGGTGG - Intergenic
1071551652 10:86570745-86570767 TCTCTTTTTTGGGGGGAGGGGGG + Intergenic
1071712681 10:88065009-88065031 TCTCAATTTCAGGTGGGGGGAGG + Intergenic
1073361169 10:102900037-102900059 TCTCATTTGGAGGTGAAAGGAGG + Intronic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1075285658 10:121183652-121183674 TCTCATTTGGGATGGGAGGGGGG + Intergenic
1075956471 10:126527453-126527475 ACTCATTGGCAGGGGTAGGGAGG - Intronic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1077474761 11:2781071-2781093 TCTCATTTGACAGGGGAGGGAGG - Intronic
1077879404 11:6336666-6336688 TCTCTTTTCCAGGGTGAGGCAGG - Intergenic
1078153463 11:8778418-8778440 TGTCAGGGGCAGGGGGAGGGTGG - Intronic
1078467801 11:11563063-11563085 TCTTGTTTGCAGGGTGGGGGTGG - Intronic
1080804431 11:35639600-35639622 CCTCACTGGCAGGGGTAGGGTGG - Intergenic
1080853492 11:36091490-36091512 TCTCTCTGGCAGAGGGAGGGAGG - Intronic
1081450936 11:43170226-43170248 TCTAATATCCAGGGGGAGAGAGG - Intergenic
1081665594 11:44915373-44915395 TCTCATTTCCAGGAGGGTGGGGG - Intronic
1083267196 11:61552112-61552134 TCACACTAGCAGGGGGAGGGAGG + Intronic
1083968408 11:66057345-66057367 TCTCATCTCCAGGGGGCGGTGGG - Exonic
1084681058 11:70666629-70666651 TCTCATCTGCATGTGGAGAGTGG - Intronic
1086813225 11:91336143-91336165 TCTCATTAGCCAGGGTAGGGTGG - Intergenic
1086920942 11:92585948-92585970 TCTCATGTGAAGGGAGAAGGTGG + Intronic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1087159606 11:94935908-94935930 AGTCATTGGCATGGGGAGGGAGG - Intergenic
1087250131 11:95889508-95889530 TCTTTTTTGGGGGGGGAGGGGGG + Intronic
1087965112 11:104403295-104403317 CCTTATTTACTGGGGGAGGGGGG + Intergenic
1088041505 11:105390006-105390028 TCTCTCTTGCAGGGAGAGAGGGG + Intergenic
1089164011 11:116460887-116460909 TTCCTTTTGCAGGGGGTGGGGGG + Intergenic
1089335288 11:117718672-117718694 TCTCATATGATGGGGGGGGGGGG - Intronic
1090874079 11:130773433-130773455 TCTCATTGGAAGGGAGAGGGAGG + Intergenic
1091404260 12:199128-199150 ACACATCAGCAGGGGGAGGGTGG + Intronic
1093821110 12:23618836-23618858 TCTCTTTTGCAGTGGGATAGAGG + Intronic
1094165063 12:27435291-27435313 TCACAATTGCCGGGGGGGGGGGG - Intergenic
1094352896 12:29546277-29546299 TGTCACTTGCAGGAGGAGGGTGG + Intronic
1095092690 12:38121639-38121661 TTTTTTTTGCAGGGGGAGTGGGG - Intergenic
1095236720 12:39805298-39805320 TCTGCTTTGCAGGGAGAGGCAGG + Intronic
1096455589 12:51782596-51782618 TTTCTTTTGTAGGGGGATGGGGG - Intronic
1097291245 12:57917162-57917184 TGTTACTTGCAGGGGGAGAGTGG + Intergenic
1098331491 12:69358459-69358481 TCTTTTTTTGAGGGGGAGGGGGG + Intergenic
1098577656 12:72061781-72061803 TTTCATATGCAAGGGGAAGGTGG + Intronic
1099180431 12:79469071-79469093 TCTAATATCCAGGGGGAGAGAGG + Intergenic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1101192900 12:102353617-102353639 TCACAATTGCAGGGCTAGGGAGG + Intergenic
1101262369 12:103046081-103046103 TGGCATTTACAGTGGGAGGGTGG - Intergenic
1102391937 12:112556407-112556429 TCTTATAAGCATGGGGAGGGAGG - Intergenic
1102792147 12:115656109-115656131 TCTTTTTTGCAGGGGGTTGGGGG + Intergenic
1104135981 12:125939404-125939426 TCTCTTTTGCAGTGGGAGCCTGG - Intergenic
1104577920 12:129984926-129984948 TTTAATTTACAGGGGGAGGAGGG - Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1106300798 13:28462902-28462924 TCTCAGTGGCAGGAGGAGGTCGG - Intronic
1106625723 13:31419170-31419192 TCTAAATTGCAGAGGAAGGGAGG + Intergenic
1106771895 13:32969525-32969547 GCTGATTTGCAAGGGGAAGGGGG - Intergenic
1107256906 13:38438587-38438609 TCTAATTTTCATGGGGGGGGTGG - Intergenic
1112687372 13:101845863-101845885 TTTCCTTTGCAGGGGGTAGGTGG + Intronic
1113079834 13:106506955-106506977 TCTCTTGGACAGGGGGAGGGTGG + Intronic
1113831442 13:113298415-113298437 TCTCATATTACGGGGGAGGGCGG - Intronic
1113970447 13:114184996-114185018 TGTCAGTTGCAGTGGGTGGGGGG + Intergenic
1114850236 14:26374493-26374515 TCTCATGTGGCGGGGGTGGGCGG - Intergenic
1116516748 14:45814506-45814528 TGTAATTTTCAGGGGGTGGGTGG + Intergenic
1117217311 14:53564893-53564915 ATTCATTGGCAGGGGGAGGTGGG + Intergenic
1117253057 14:53954235-53954257 TCTGCTTTGCATGGGGAGAGGGG - Intronic
1117268547 14:54116662-54116684 TCTCATTAGTAGGTGTAGGGTGG - Intergenic
1118558993 14:67057279-67057301 TGTCCTTTGCAGGGACAGGGAGG + Intronic
1118761932 14:68885350-68885372 TCTCAGCTGCTGGGGGAGGTGGG - Intronic
1118901167 14:69987117-69987139 TCACATGTGGAGGGGGATGGTGG + Intronic
1119232592 14:72992618-72992640 TCTCTCTTGCAAGGGGCGGGGGG - Intronic
1119816693 14:77575386-77575408 TCCCATTTGGAGGTGGAGGAGGG + Intronic
1119882982 14:78116221-78116243 CCTAATTTGAAGGTGGAGGGAGG - Intergenic
1120749925 14:88187847-88187869 TCGGTTTTGCAGGGGGAGCGGGG - Intronic
1202849954 14_GL000225v1_random:10010-10032 ACGCATTTTCCGGGGGAGGGTGG - Intergenic
1123449316 15:20350172-20350194 TCCCATGGGCAGGGGGAGAGTGG + Intergenic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1125049548 15:35281099-35281121 TCATATTTGTGGGGGGAGGGGGG - Intronic
1127414812 15:58748560-58748582 TTTCATGTGCAGGGGGGAGGGGG + Intronic
1127716789 15:61656050-61656072 TTCAACTTGCAGGGGGAGGGTGG - Intergenic
1128777178 15:70329416-70329438 CCTCATGTCCAAGGGGAGGGAGG - Intergenic
1128911687 15:71521242-71521264 TCTTGTTTGCAGGGAGAGTGGGG - Intronic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129852820 15:78804301-78804323 TCTCATGTGCCGGGGGTTGGGGG + Intronic
1129977944 15:79838282-79838304 TCTGATTTGCAAGTGGAGGGAGG - Intronic
1132362313 15:101226672-101226694 TCTCATATGCTGGTGGAGCGAGG - Intronic
1132622402 16:874054-874076 TCTCCTTTGCCGGGTGTGGGGGG + Intronic
1133101404 16:3482327-3482349 TCTCATTTCCTTGGGGAGTGGGG + Intronic
1134067892 16:11240958-11240980 TCTCAGTGGGAAGGGGAGGGTGG + Intergenic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135941417 16:26825373-26825395 TCTCTTTTCCAGAGGGAGAGAGG - Intergenic
1136366279 16:29810669-29810691 TTTTTTTTCCAGGGGGAGGGAGG + Exonic
1137573688 16:49584136-49584158 TCTCATTTTCATGGGAAGTGTGG - Intronic
1137782808 16:51112066-51112088 TTGCATTTGAAGGGGGTGGGGGG + Intergenic
1138799685 16:60012874-60012896 TTCCATTTGCTGGGAGAGGGAGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139646688 16:68336526-68336548 TCTAGGTTGCAGGGAGAGGGAGG - Intronic
1139956434 16:70695438-70695460 TCTCTTTTGGCTGGGGAGGGAGG - Intronic
1139967360 16:70753261-70753283 TCTCATTAGCAGTGGGGGGACGG + Intronic
1140063975 16:71594319-71594341 TCTCATTTGTGGAGGGAGTGGGG - Intergenic
1142109534 16:88323822-88323844 ACCCTTTTGCAGGGGGATGGGGG - Intergenic
1142430640 16:90024656-90024678 TCTCTTTTTCAGGGGGAGTTGGG + Intronic
1142738999 17:1919538-1919560 GCTCATTAGCTTGGGGAGGGGGG + Intergenic
1142825689 17:2508718-2508740 TCACATTTGCATGGGGGGAGTGG - Intronic
1143167468 17:4904195-4904217 TGTTTTTTGCAGGGGGTGGGGGG + Intergenic
1143503325 17:7351281-7351303 TCTCATCTCCTGGGGGAGGGAGG - Exonic
1146449371 17:32960412-32960434 TCTGATTTGAAGTGGGAGTGGGG + Intergenic
1146638795 17:34525250-34525272 TCTTAACTGCAGGGGTAGGGGGG - Intergenic
1146684320 17:34830606-34830628 TCTCTTGTGCTGGGGGAGTGGGG - Intergenic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147017767 17:37506272-37506294 TCTTTTTTGCAGGGGGACGGGGG - Intronic
1147178473 17:38671154-38671176 TTTCACTTGCAGGGCGGGGGTGG + Intergenic
1148853647 17:50566984-50567006 TCTCCTCTGCAGGGAAAGGGGGG - Intronic
1149256942 17:54837213-54837235 TCTAGCTTGCAGGGGCAGGGAGG + Intergenic
1149299035 17:55287257-55287279 TCTTATTTACAAGGGGAAGGGGG - Intronic
1149913240 17:60585329-60585351 TCTTTGTTGCAGGGGGCGGGAGG + Intronic
1150816573 17:68396692-68396714 TCTGGTTTGCTGGGGGAGGCTGG - Intronic
1151339134 17:73458560-73458582 TGTCATTTGCAGGGAGATTGTGG - Intronic
1151348292 17:73516548-73516570 TCTCATTTGTGGGAGAAGGGAGG - Intronic
1151702522 17:75750922-75750944 TGTCAGTGGCAGAGGGAGGGAGG - Intronic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1152130333 17:78472455-78472477 TCTCATTTGCAGGAAGCTGGCGG + Intronic
1152339325 17:79715694-79715716 TCCCATGGGCAGGGGGAGAGTGG - Intergenic
1155427826 18:25724645-25724667 TCTCTTTTGAAGGGTGACGGGGG - Intergenic
1155779379 18:29811756-29811778 GCTCACTGGCAGGGGTAGGGTGG - Intergenic
1156870485 18:41939761-41939783 CCTCATTTGAAGGGGGATGAAGG - Intergenic
1157212347 18:45754418-45754440 GTTGATTTGCAGGGTGAGGGAGG + Intergenic
1158823686 18:61190175-61190197 TCTATGTTGCAGGGGGATGGGGG + Intergenic
1158836286 18:61334224-61334246 TCCCCTCTGCAGGCGGAGGGAGG - Intronic
1160519766 18:79498049-79498071 TCCTATTTGGAGGGGGATGGGGG + Intronic
1160947543 19:1650742-1650764 TGCCATCTGCTGGGGGAGGGGGG - Intronic
1161582551 19:5088663-5088685 GCTCTTTTGCGGGGGGGGGGAGG - Intronic
1162209586 19:9080731-9080753 TCTCATTTCACAGGGGAGGGAGG + Intergenic
1164726194 19:30467592-30467614 TGTCTTGTGCAGGGGAAGGGAGG - Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165304384 19:34994769-34994791 TCAGACTTGCAGGGGAAGGGCGG - Intronic
1166197305 19:41215596-41215618 TCTTTTTTGGGGGGGGAGGGGGG + Intergenic
1166317705 19:41998284-41998306 TCTCATTTCCTGGGGGTGTGAGG - Intergenic
1167156694 19:47743169-47743191 TCTCTTTCCCTGGGGGAGGGCGG - Intergenic
1167698231 19:51027209-51027231 TCTCCTTTGCAAGGAGAGGGGGG + Intronic
1168475650 19:56673373-56673395 TCTCACATGTAGGGAGAGGGGGG - Intergenic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
925812188 2:7711636-7711658 CCTGGTTTGCAGGTGGAGGGTGG - Intergenic
926386056 2:12336906-12336928 TCTTGTTTACATGGGGAGGGGGG - Intergenic
927148929 2:20184821-20184843 TCTCACTGGCAGGGTGGGGGAGG + Intergenic
929235921 2:39605497-39605519 CCTCATTTGCAGGTGTACGGTGG + Intergenic
929546214 2:42856644-42856666 CCTCAGATGCAGGGAGAGGGTGG - Intergenic
929878983 2:45820399-45820421 TTTTATTTGGAGGGGGAGAGGGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931033375 2:58210415-58210437 TCTCATGTGTTGTGGGAGGGCGG - Intronic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933412170 2:81940352-81940374 TCTCTTGTGGAGGGGGTGGGGGG - Intergenic
934507509 2:94905638-94905660 TCTACTATGCAGGGGGTGGGGGG + Intergenic
935333705 2:101996175-101996197 GCTCATTTGGGGTGGGAGGGAGG + Intronic
937920043 2:127122418-127122440 GCTGATGTGCAGGGAGAGGGAGG - Intergenic
937986995 2:127642461-127642483 TCTGGTTTGGAGGAGGAGGGGGG - Intronic
939741104 2:145907548-145907570 TTTCATTTGCTGGGGGGGTGGGG - Intergenic
941067769 2:160922361-160922383 CCTCATTTTCAGTGGGAGAGGGG + Intergenic
941295075 2:163727956-163727978 TCTAATTTTCAGGGAGAGGGAGG + Intronic
941999390 2:171630999-171631021 TTTCATTTTCAGGGTCAGGGTGG - Intergenic
944075602 2:195727184-195727206 TCTTATTTGGAGGGAGGGGGTGG + Intronic
944425316 2:199576053-199576075 TCACATTTGCAGTGTCAGGGAGG - Intergenic
944436593 2:199696381-199696403 CTTCAATGGCAGGGGGAGGGAGG - Intergenic
944561270 2:200940902-200940924 TTTCTTTTGCAGGGGGAAGAGGG - Intronic
944677548 2:202046927-202046949 TCTCATTTTCAAGGGGAGTTTGG - Intergenic
947033435 2:225824458-225824480 TTTCCTTGGCTGGGGGAGGGAGG - Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
947928676 2:233943621-233943643 AAACATTTGCAGGGGGCGGGGGG - Intronic
948058202 2:235025231-235025253 TCTCAGCGGCAGGGTGAGGGCGG + Intronic
949026364 2:241768174-241768196 CCTCCTTTGCAGGGCGAGGTGGG + Exonic
1169324677 20:4665491-4665513 TCCCATTTCCAGGATGAGGGAGG + Intergenic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1170731861 20:18982965-18982987 CATCATTTGCAGGGAGTGGGAGG + Intergenic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172186096 20:33031937-33031959 TCTAACTTGCAGGGGGAGCATGG - Intronic
1172547569 20:35773246-35773268 TCTCATTTCCAGGTGGCGAGTGG + Intronic
1173213756 20:41059586-41059608 TCTCTTTTGCAGGGAAAGGCAGG - Intronic
1173250843 20:41363570-41363592 GCTCAGTGGCAGGGGCAGGGAGG - Intronic
1175414203 20:58790864-58790886 TCTCCTTAGCAAGTGGAGGGTGG - Intergenic
1175485347 20:59342183-59342205 TGTCCTTTGCAGGGGGAGCTTGG + Intergenic
1177250867 21:18589170-18589192 AGTCATTTGCAGGGGGTGGTAGG - Intergenic
1177888016 21:26769477-26769499 TATCATTTAGAGGGGGAGAGTGG + Intergenic
1178435110 21:32551340-32551362 TCTCTTTTGGAATGGGAGGGAGG - Intergenic
1178466131 21:32849787-32849809 TTTCACTTGCAGGAGCAGGGAGG + Intergenic
1178535632 21:33407987-33408009 TCTCATCTGCAAGGTGATGGAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179600531 21:42474654-42474676 TCTGACTTGCACAGGGAGGGTGG - Intronic
1179913791 21:44463660-44463682 TGTCATTTTCAGGTGGATGGTGG - Intergenic
1180637507 22:17272666-17272688 GCTCATTCCCAGAGGGAGGGAGG - Intergenic
1181930427 22:26396323-26396345 TTTCTTTTGCATGGGGAGGTAGG - Intergenic
1182427743 22:30283801-30283823 TGTCTTTTGTTGGGGGAGGGGGG - Intergenic
1183069720 22:35387659-35387681 TCTCAAATCCAGGGGGAAGGTGG + Intronic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1184098087 22:42327390-42327412 TCTCATTGGCAGGTTGGGGGAGG - Intronic
1184790432 22:46696450-46696472 TCTCAAGTGCAGGGGGCAGGGGG + Intronic
949346353 3:3080407-3080429 TCAGTTTTGCAGAGGGAGGGAGG - Intronic
949427143 3:3929732-3929754 TATCATTTGTAGGGGGATGGGGG + Intronic
949661947 3:6289984-6290006 TTTTATTTGCAGGTGGAAGGTGG + Intergenic
949762889 3:7491567-7491589 TCTCATTGACAAGGTGAGGGAGG + Intronic
950573830 3:13818907-13818929 TCTGACTTGCAGCGGGAGGGTGG + Exonic
952818955 3:37469298-37469320 TCTGTTTTGCAGTGGGAGAGAGG + Intronic
953773849 3:45799248-45799270 AGTCCTTTGTAGGGGGAGGGCGG - Intergenic
955525000 3:59810709-59810731 TGTACTTTGGAGGGGGAGGGTGG - Intronic
955760722 3:62278935-62278957 GCTCATTTGTATGGGGAGGCTGG + Intronic
956128653 3:66034886-66034908 TCTATGGTGCAGGGGGAGGGGGG + Intronic
956210147 3:66794089-66794111 TTTCATTTTCATGGGGAAGGTGG + Intergenic
957254935 3:77824953-77824975 TCTCTTCTGTAGGGGGTGGGGGG + Intergenic
958915303 3:100043505-100043527 TCTCATTTGCTGTGGGAGACAGG + Intronic
960383451 3:116992049-116992071 TCTCATTTCCAGTGGTAGGTGGG + Intronic
960412736 3:117347851-117347873 TCTCATGTTCTGGGGAAGGGAGG - Intergenic
960965078 3:123098891-123098913 AGTCATTGGCTGGGGGAGGGAGG + Intronic
960986716 3:123285784-123285806 TCTCCTTTGCACAGGGATGGAGG + Intronic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962154006 3:132924887-132924909 GCTCCTTTGCGGGGGGAGGGGGG - Intergenic
963892718 3:150653593-150653615 TGTCATGTGCGGGTGGAGGGAGG - Intergenic
964768499 3:160200925-160200947 TATTATTTGCAGGGGTGGGGTGG + Intergenic
965166347 3:165197317-165197339 TTACATTTGCCGGGGGCGGGGGG + Intergenic
966310107 3:178584432-178584454 TTTCTTTTGGAGAGGGAGGGAGG - Intronic
966457014 3:180128656-180128678 TTTCAATTGCATGGGGGGGGAGG + Intergenic
967381168 3:188859789-188859811 TGTCATCTTCAGGGGTAGGGGGG + Intronic
968830850 4:2932435-2932457 TGCCATTTCCAGGGGCAGGGAGG + Exonic
968988455 4:3892697-3892719 TCTCATGTCCAGGGGAAGAGAGG + Intergenic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
969641148 4:8399461-8399483 TCTCCTTTCCAGGTGCAGGGAGG + Intronic
969670942 4:8590029-8590051 TCTCATTTCCATGGAAAGGGGGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
969918136 4:10510218-10510240 AATCACTTGCGGGGGGAGGGGGG + Intronic
969987164 4:11224350-11224372 TGTCAATTTCATGGGGAGGGGGG - Intergenic
970950010 4:21743636-21743658 TTTTTTTTGTAGGGGGAGGGGGG + Intronic
971293204 4:25363849-25363871 TGTTATTTGGAGGGGAAGGGAGG + Intronic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
974208361 4:58736939-58736961 TCACATTTGCAGGGGAAGACTGG + Intergenic
978109064 4:104940183-104940205 TCTCATTTGCTGTGGGAAGGTGG - Intergenic
978292055 4:107153071-107153093 TCTGATTTGCAGGCTGCGGGTGG + Intronic
979107361 4:116705359-116705381 TCTGAGGAGCAGGGGGAGGGCGG - Intergenic
983331457 4:166333978-166334000 TTCCCTTTGCTGGGGGAGGGAGG + Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
985069139 4:186151029-186151051 TCCCATGTGCAGTGGGAGTGGGG - Intronic
985687236 5:1289130-1289152 TCTCAGGTGCAGGGTGAGTGAGG - Intronic
985687419 5:1289844-1289866 TGTCACTTGCAGGGTGAGTGAGG - Intronic
986007725 5:3682007-3682029 TCCCATTTGGAGGGGGTGGAGGG + Intergenic
986327583 5:6687957-6687979 TTTTATTAGCTGGGGGAGGGGGG + Intergenic
986615989 5:9618187-9618209 TCTCAAAGGCAGGGGTAGGGTGG + Intergenic
987784323 5:22479526-22479548 TAAAATTTGCAGGGTGAGGGAGG + Intronic
988060334 5:26159319-26159341 TCCAATTTGCAGGGGGTGGGTGG + Intergenic
988683203 5:33503178-33503200 TCTCTGTGGCAGGAGGAGGGTGG - Intergenic
990283553 5:54277261-54277283 TCTTTTTTGCGGGGGGAGGGAGG - Intronic
991392903 5:66167672-66167694 TCTCAATTGCAGGGTAAGGTTGG + Intronic
991593253 5:68276439-68276461 ACTCCATTCCAGGGGGAGGGAGG + Intronic
992130049 5:73682885-73682907 TCAAATGTGCAGTGGGAGGGAGG + Intronic
993872282 5:93267378-93267400 TCTCATTTGGATGAGGCGGGTGG - Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
997419516 5:133755031-133755053 TCTGGCTTGCAGGGGGATGGAGG - Intergenic
997441365 5:133910986-133911008 TCACTTTTGCTGGGGAAGGGGGG - Intergenic
998072258 5:139207311-139207333 TCTCATTTTTAGCTGGAGGGAGG - Intronic
998150017 5:139751466-139751488 TCACACTTGAAGGGGGTGGGAGG - Intergenic
998440878 5:142161188-142161210 AATTATTTGCCGGGGGAGGGAGG - Intergenic
999523376 5:152376190-152376212 ACTCATATGCAGTGGGATGGGGG + Intergenic
1000249687 5:159482213-159482235 GCTTATTAGCAGGTGGAGGGTGG - Intergenic
1001280509 5:170383119-170383141 TGTGTTTTGGAGGGGGAGGGTGG + Intronic
1001385574 5:171335851-171335873 TCCCATATGCCCGGGGAGGGGGG + Intergenic
1001710048 5:173771278-173771300 TCTCACTGCCAGGGAGAGGGAGG + Intergenic
1002857974 6:1055119-1055141 TTCCATGTGGAGGGGGAGGGTGG + Intergenic
1004919040 6:20358929-20358951 TCTCTTTTGGAGGTGGAGAGAGG + Intergenic
1006775664 6:36590554-36590576 CCTCTTTTTCAGGGGTAGGGAGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1009227905 6:61034640-61034662 TCTCATAAGCGGGGGGATGGGGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1010256988 6:73770110-73770132 TCTCATTCTCTGTGGGAGGGTGG - Intronic
1014542470 6:122693304-122693326 TCTCACTAGCAGGGGGCGGTGGG - Intronic
1016889243 6:148989213-148989235 TTTCATTTGCGGGGGGTGGGGGG - Intronic
1017616912 6:156255640-156255662 TCTCTTTTGGAATGGGAGGGAGG - Intergenic
1017889101 6:158624742-158624764 TCCCACATGCAGGGGCAGGGTGG + Intronic
1017904943 6:158751543-158751565 TTTCTTTTGCAGGTGGTGGGTGG + Intronic
1018186486 6:161269522-161269544 TCCCAGCTGCTGGGGGAGGGGGG + Intronic
1019082685 6:169445929-169445951 GCTCTGTTGCAGAGGGAGGGGGG - Intergenic
1019441876 7:1051565-1051587 TCTCATTTGGATGGGGTGAGAGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1021421404 7:20449222-20449244 TTTTTTTTGGAGGGGGAGGGTGG - Intergenic
1022062484 7:26811641-26811663 TATCACCTGCAGGTGGAGGGGGG - Intronic
1022195894 7:28067027-28067049 TCTCATTTTCAAGGGTAGGCAGG - Intronic
1022427722 7:30284724-30284746 CCTCCTTCGCAGGGGGAGCGAGG + Exonic
1023792378 7:43763181-43763203 TCTGGTTTGAAGGGGTAGGGAGG + Intronic
1023846174 7:44121868-44121890 TCTCATTTGGATGAGGCGGGTGG + Exonic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1023990462 7:45125534-45125556 TCCCATCTGTTGGGGGAGGGAGG - Intergenic
1024616340 7:51117078-51117100 TATTTTGTGCAGGGGGAGGGGGG - Intronic
1024626928 7:51215834-51215856 TCTCAGGTGCAAGGGAAGGGAGG - Intronic
1026235099 7:68520500-68520522 TATGATTAGCAGGGGAAGGGTGG - Intergenic
1026932942 7:74234955-74234977 TCCCAACTGCAGTGGGAGGGAGG - Intronic
1028168928 7:87572736-87572758 TGTCCTTTGCAGGGACAGGGAGG + Intronic
1028343537 7:89752437-89752459 TCCTATTTGAAGGTGGAGGGAGG + Intergenic
1028610417 7:92704114-92704136 TCTATTTTAGAGGGGGAGGGTGG - Intronic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1029535398 7:101154716-101154738 GCGCATTTGCAGGGCGAGCGGGG + Intronic
1030787340 7:113678542-113678564 TCTGATTTTCAGGTGGTGGGAGG + Intergenic
1032121442 7:129160038-129160060 TCTTTTTTGCGGGGTGAGGGAGG - Intronic
1032478897 7:132230927-132230949 TCTCTCTTCCAGGGGTAGGGAGG + Intronic
1032495501 7:132358797-132358819 TCTCATAGGCAGGGCTAGGGTGG + Intronic
1032885009 7:136128209-136128231 GCTCATCTGCAGGGGGCGTGAGG + Intergenic
1033099710 7:138460162-138460184 CCTCAGTTGCTGGGAGAGGGAGG + Intergenic
1034193197 7:149226371-149226393 GATCAGTTGCTGGGGGAGGGGGG + Intergenic
1034887246 7:154807154-154807176 GCACATTTGCAGGGAGGGGGTGG + Intronic
1035017479 7:155779210-155779232 TTTAATTTGGAGTGGGAGGGAGG + Exonic
1036238804 8:7065413-7065435 TCTCATGTGCAGGGTGGGAGAGG - Intergenic
1037325843 8:17689255-17689277 AATTATTTGTAGGGGGAGGGAGG + Intronic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1038394258 8:27235431-27235453 TCATGTTTGCAGGGGAAGGGAGG + Exonic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1039614999 8:38948516-38948538 CCTGATTTGGAGGGGTAGGGAGG + Intronic
1041313514 8:56539478-56539500 TGGCAGTTGCAGAGGGAGGGAGG + Intergenic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1044360520 8:91278068-91278090 TTTCAGTGGCAGGGGGAGGAGGG + Intronic
1045058022 8:98385736-98385758 TCTCTTTTTCAGGGTGTGGGGGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1045999812 8:108406157-108406179 TCTCAGTTGAAGAGGGAGTGTGG - Intronic
1049421355 8:142517980-142518002 CCTCGTCTGCAGGGGGCGGGTGG + Intronic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1050057851 9:1674346-1674368 TCTCATTTGGATGGGCATGGAGG - Intergenic
1050835662 9:10075668-10075690 TCTCATTTTCTGGGGGGGAGGGG + Intronic
1051215789 9:14795905-14795927 TCTCATTTTAAGAGGCAGGGAGG - Intronic
1052323929 9:27197008-27197030 GTTCAATTGCCGGGGGAGGGGGG - Intronic
1052628256 9:31004659-31004681 TTCCCTTGGCAGGGGGAGGGAGG - Intergenic
1056289572 9:85129078-85129100 TGTGAATTGCAGGGGGAGGTGGG - Intergenic
1056930079 9:90867000-90867022 TCTCATTGGCAGGGACAGGAGGG + Intronic
1057568626 9:96186509-96186531 TGTTATTTGCAGGGGTAGTGGGG + Intergenic
1058518381 9:105797291-105797313 TCTAATATCCAGGGGGAGAGGGG - Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060767402 9:126305155-126305177 TCTGGTTTGCAGAGGGAGTGTGG - Intergenic
1060849345 9:126861116-126861138 TCCCTTTTGTACGGGGAGGGAGG + Intronic
1061259032 9:129469534-129469556 TCACAATTGCATGGGGAAGGGGG - Intergenic
1061417329 9:130454208-130454230 TCTCTGTAGCAGGGGGTGGGAGG + Intronic
1062117938 9:134819064-134819086 TCACAGTTGCTGGGGCAGGGAGG - Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186836236 X:13441165-13441187 TTGAATTTGCAGGGGGTGGGGGG + Intergenic
1188915527 X:35905100-35905122 TTTCCTTGGCTGGGGGAGGGAGG + Intergenic
1189212741 X:39298506-39298528 TCTCAATTGTTGGGGGAGGAGGG - Intergenic
1189908836 X:45789221-45789243 TGTCATTTCCAGGAGCAGGGCGG - Intergenic
1190217763 X:48491526-48491548 TCACACTTGCACGGGGCGGGGGG - Intergenic
1192133152 X:68571764-68571786 TATCTTTTCCAGGGGAAGGGTGG + Intergenic
1194584712 X:95718138-95718160 TTACATTTTCAGGGAGAGGGGGG + Intergenic
1196176713 X:112646339-112646361 CCTGGTTTGCGGGGGGAGGGGGG + Intronic
1198380410 X:136078170-136078192 ACTCATTTTCAGGGGGTGGGGGG + Intergenic
1199342748 X:146700634-146700656 TCTGATTTACGGGGAGAGGGAGG + Intergenic
1200176512 X:154120928-154120950 TTTCTTTTTTAGGGGGAGGGGGG + Intergenic
1200215329 X:154365706-154365728 TCTTCTTGGAAGGGGGAGGGTGG - Intronic
1202029187 Y:20553730-20553752 TTTGAGTTGCAGGGGGTGGGGGG + Intergenic