ID: 969843040

View in Genome Browser
Species Human (GRCh38)
Location 4:9897578-9897600
Sequence CCACACTTTCCCTTTTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969843040_969843043 2 Left 969843040 4:9897578-9897600 CCAATGGAAAAGGGAAAGTGTGG 0: 1
1: 1
2: 1
3: 26
4: 262
Right 969843043 4:9897603-9897625 ACGGAGACAGACACGCACACAGG 0: 1
1: 0
2: 16
3: 108
4: 622
969843040_969843045 24 Left 969843040 4:9897578-9897600 CCAATGGAAAAGGGAAAGTGTGG 0: 1
1: 1
2: 1
3: 26
4: 262
Right 969843045 4:9897625-9897647 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
969843040_969843047 27 Left 969843040 4:9897578-9897600 CCAATGGAAAAGGGAAAGTGTGG 0: 1
1: 1
2: 1
3: 26
4: 262
Right 969843047 4:9897628-9897650 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
969843040_969843044 23 Left 969843040 4:9897578-9897600 CCAATGGAAAAGGGAAAGTGTGG 0: 1
1: 1
2: 1
3: 26
4: 262
Right 969843044 4:9897624-9897646 GGCCTGTAATCCCAGCACTTTGG 0: 4832
1: 222861
2: 273207
3: 187102
4: 182881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969843040 Original CRISPR CCACACTTTCCCTTTTCCAT TGG (reversed) Intronic
904840069 1:33367027-33367049 TCACACTTTCCTTTTTCCCATGG - Intronic
905175953 1:36135436-36135458 CCGCCCTTTCCCTTCTCCAGGGG - Intergenic
905338527 1:37262090-37262112 CCTCATTCTCCATTTTCCATGGG + Intergenic
906077391 1:43062128-43062150 CCACCCTTTCCCCTTTAAATTGG + Intergenic
907072478 1:51549227-51549249 CCACACATCCCCTTCTCCTTTGG + Intergenic
911674520 1:100644221-100644243 TCTAACTTTACCTTTTCCATTGG - Intergenic
911910283 1:103626137-103626159 CAAAACATTCCTTTTTCCATAGG + Intergenic
911917701 1:103720262-103720284 CAAAACATTCCTTTTTCCATAGG + Intronic
914750245 1:150530083-150530105 CCACACTGCCCCTTGTCAATAGG - Intergenic
914973822 1:152338506-152338528 TCATACTTTGCCTTTTCTATAGG + Intergenic
916586518 1:166154350-166154372 CCATACTTTCCCCTTCCCTTGGG + Intronic
917674642 1:177307185-177307207 CCTCACTGCCCCTTTTCCTTTGG - Intergenic
918108947 1:181438922-181438944 CCACACTTTATCTATTCCCTTGG - Intronic
919430456 1:197485753-197485775 CCACCCTTTCCCTACTCCCTTGG + Intergenic
920804223 1:209218086-209218108 CTCCAATTTCCCCTTTCCATGGG + Intergenic
922447687 1:225711353-225711375 CCTTACTCTGCCTTTTCCATAGG - Intergenic
1063428505 10:5967729-5967751 CCACACTTGCACTTTTCCAGGGG - Intronic
1063849117 10:10164224-10164246 CCACCCTTTCCCCTTTAAATTGG + Intergenic
1064320360 10:14299002-14299024 CCAAAGTTTCCCATTTCCCTGGG + Intronic
1065426838 10:25615134-25615156 TCTCACTCTCCCCTTTCCATAGG + Intergenic
1066308266 10:34169083-34169105 ACACACTTTCCCCTTTGAATAGG + Intronic
1066388412 10:34959982-34960004 CCTCACTTCCCCTTTCCCAAGGG - Intergenic
1067833068 10:49621366-49621388 CCACACCTTCCTTCTTCCCTGGG - Intronic
1068639068 10:59381468-59381490 CCCTCCTTTCCCATTTCCATGGG + Intergenic
1070387554 10:75939591-75939613 CAACACTCTCTCTTTCCCATGGG - Intronic
1071138207 10:82476974-82476996 CCAGACTTTCCCTTTTGGAAAGG + Intronic
1071846225 10:89523984-89524006 TCACTCTTTCCCTTTTCCTCAGG + Intronic
1072009321 10:91289813-91289835 CCACACTGTCCCTCTTCCAGTGG - Intergenic
1072054626 10:91741881-91741903 CCTCATTTTCCCTTTTCTGTAGG + Intergenic
1073024851 10:100480403-100480425 CCACTCTTTATCTTCTCCATGGG - Intronic
1074637089 10:115332021-115332043 CTACTCTTTCTTTTTTCCATAGG + Intronic
1077799741 11:5525718-5525740 CTACACTCTTCCTTTTCTATAGG - Intronic
1077896535 11:6457522-6457544 CCGAACTTTCCCTTCTCCCTGGG + Intronic
1078047595 11:7930893-7930915 CAACACTTACCTCTTTCCATTGG - Intergenic
1078598940 11:12714041-12714063 CTACACGTTCCCTCTTCCACTGG - Intronic
1080569529 11:33543237-33543259 TCACACTGTCCTTTTTCCACCGG - Exonic
1082648320 11:55755749-55755771 CCACCGTCTCCATTTTCCATGGG + Intergenic
1082751119 11:57018827-57018849 CCACAGTTGCCATTTTCTATGGG + Intergenic
1083032636 11:59607518-59607540 CCAGACTTTCCCATGACCATGGG - Intronic
1084029286 11:66471641-66471663 CCACCCATTTCCATTTCCATTGG - Intronic
1086464062 11:87035933-87035955 ACATACCTTCCCTTTTCCAAGGG - Intergenic
1088026229 11:105187009-105187031 CCACACTTAGCCTTTTACATGGG - Intergenic
1089491000 11:118884061-118884083 CCACACTGTCCCCTCTCCCTCGG - Intronic
1090711514 11:129390549-129390571 CCTCACTCTCCCTTCCCCATTGG - Intronic
1091962007 12:4703757-4703779 CCAAACTTGTCCTTTTTCATTGG + Intronic
1093713047 12:22349729-22349751 ACACACTTATTCTTTTCCATGGG - Intronic
1094031593 12:26017957-26017979 AAACCCTTTCCCTTTCCCATTGG + Intronic
1095998414 12:48109082-48109104 AGACACTTTCCCTGTTCCCTAGG + Intronic
1097377251 12:58855740-58855762 CCAGCTTTTCCCTTTTCCAGAGG + Intergenic
1097968164 12:65603466-65603488 CCACACTTTCCCTTTTGCATTGG - Intergenic
1098120865 12:67236887-67236909 GGACACTCTCCCTTTTCCCTAGG + Intergenic
1099208117 12:79751556-79751578 CCTTAATTTCCCTTTACCATAGG + Intergenic
1099657671 12:85515165-85515187 CCACATTTTCCCTATTTGATAGG - Intergenic
1100981829 12:100168118-100168140 CAACACTTTCACTATTCCATGGG - Intergenic
1101064034 12:101001160-101001182 CAACTCTTTCCCTTTCCTATAGG - Intronic
1101230768 12:102738619-102738641 CTACGATTTCCCTCTTCCATGGG + Intergenic
1101252537 12:102950396-102950418 GTACACTTTCCCTTTGCCCTCGG + Intronic
1103408710 12:120695074-120695096 CCACTGTTTCCCTTTTCCTAGGG + Exonic
1103483295 12:121265296-121265318 CCACACCCTCCCTTTTCCTTTGG - Intronic
1103782407 12:123407728-123407750 CCCCACTTTCCCTTCTTCAAAGG + Exonic
1104090401 12:125512016-125512038 CCACTCTTACCCTTGTCCATAGG - Intronic
1104390329 12:128386430-128386452 CCACATTTTCCCTTTCCGTTGGG + Intronic
1104739136 12:131159856-131159878 CCACCCTCTCCCTTTCCCAAAGG + Intergenic
1105217693 13:18298758-18298780 CCCCACTTTCCCTTCTTCAAAGG + Intergenic
1107008720 13:35645898-35645920 CCACACTTTCCTTCTTACAAAGG + Intronic
1109313600 13:60723810-60723832 CCTCACTTGACTTTTTCCATTGG - Intergenic
1111344157 13:86926657-86926679 CTTCCCTTTCCCTTTTCCAGGGG + Intergenic
1113704628 13:112419691-112419713 CCAAACTTTGCCTTTTACAGTGG - Intronic
1113725314 13:112594821-112594843 ACACACTTTTCATTATCCATGGG - Intergenic
1115165447 14:30443652-30443674 AAACACTTTCCCTTTGCTATAGG - Intergenic
1115409441 14:33056823-33056845 CATTACTTTCCATTTTCCATAGG - Intronic
1116752152 14:48899751-48899773 CTACACTTCCCCTTTACCAAGGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1117624279 14:57619085-57619107 CCACAGTTGCCCCTTTCCCTAGG - Intronic
1118277754 14:64400771-64400793 CCACCCTTTCCTTTTTCTCTAGG + Exonic
1120052110 14:79878811-79878833 CCTCACATTCCCTTTCCCAAAGG + Intergenic
1120245851 14:82005463-82005485 CCACAATTTCCCTTTGCCCTTGG + Intergenic
1120596143 14:86439885-86439907 CCACACTTTCCCTTTGCACGGGG - Intergenic
1121330870 14:93049078-93049100 CTACACTGTCCCTTTTCCTCTGG - Intronic
1121903590 14:97718642-97718664 TCACACTTTCTCTTTTCTCTCGG + Intergenic
1122141121 14:99663733-99663755 CCACTACTTCCATTTTCCATAGG - Intronic
1123130195 14:105979243-105979265 ACACAGTTTTCCTTTCCCATGGG + Intergenic
1124925261 15:34064253-34064275 CCACTTTTTTCTTTTTCCATCGG - Exonic
1125032584 15:35087280-35087302 CCACATGTTCCCTTTGCCAGCGG - Intergenic
1127708564 15:61571886-61571908 ACACACTTTCATTTTTCCTTGGG + Intergenic
1128056895 15:64706436-64706458 CCACAAAATCCCTGTTCCATTGG + Intergenic
1128078861 15:64844367-64844389 CCACCCTTTTCCTTTTACAAAGG - Intronic
1129272138 15:74424645-74424667 CCACACTGTCCCTTCTCCCTAGG - Intronic
1130838937 15:87679404-87679426 TAACATTTTCCCTTTTGCATAGG - Intergenic
1131700311 15:94928353-94928375 GCACAGCTTCCCTTTTACATTGG - Intergenic
1133894859 16:9916925-9916947 CCCAACTTTCCCTTTTGCAGAGG + Intronic
1133926527 16:10197443-10197465 CCACACTTAACCTCTTCCAGTGG + Intergenic
1134273273 16:12753717-12753739 ACACACTTCCCGTTTTCCACAGG + Intronic
1135594095 16:23728137-23728159 CCCCACTCTCCCTTCTCCGTGGG - Intergenic
1139010114 16:62621697-62621719 CCAAACTTACCCTGTTTCATAGG - Intergenic
1140079096 16:71727733-71727755 ACACCCTTCCCCTTTTCAATCGG + Intergenic
1140685183 16:77426722-77426744 CCACCCTATCCTTTTTTCATTGG - Intronic
1141582845 16:85011879-85011901 CCTTACTTTCCCATTTCCTTCGG - Intergenic
1141657811 16:85425342-85425364 CCACCCTTTCCCTTGGCCCTGGG - Intergenic
1142508078 17:378328-378350 CTACACCTTCCCTTTTCCATGGG - Intronic
1142798115 17:2324977-2324999 CCACACTTAACCTTGTCAATAGG + Exonic
1143685016 17:8506865-8506887 CACCCCATTCCCTTTTCCATGGG + Intronic
1144247204 17:13378801-13378823 CAACACTTTTCCTTTTTCTTGGG - Intergenic
1144734268 17:17546244-17546266 CCACACATGCCCTTCTCCACAGG - Intronic
1146275363 17:31512705-31512727 CCACACTGTCCCTTCCCCAAAGG + Intronic
1146562509 17:33883492-33883514 CCATACTTCCCCCTTTCCACAGG + Intronic
1148739851 17:49886566-49886588 CCACTCTCTCCTTTTTCCCTTGG + Intergenic
1149395991 17:56244294-56244316 CTTCACTTTACCTTTTCCACTGG - Intronic
1150155607 17:62850582-62850604 CCAGACTTTTCCTTTTCAATAGG + Intergenic
1150672821 17:67216860-67216882 TCACACTTTCCCCTTTCCTCAGG + Intronic
1151076077 17:71274162-71274184 CCACACTTTGGCCTTGCCATTGG - Intergenic
1151091067 17:71440669-71440691 CCCAAGTTGCCCTTTTCCATAGG + Intergenic
1151129216 17:71878798-71878820 CCAAATTTTCCATTTTCAATTGG - Intergenic
1158191143 18:54830108-54830130 CCACAGTTCCCCTTTCTCATAGG + Intronic
1161880821 19:6950853-6950875 CTTCATTTTCCCTTTTCCAAAGG + Intergenic
1162251589 19:9448730-9448752 CCACTCTGTCCCTTTTAAATGGG - Intergenic
1162618742 19:11822874-11822896 TCACAATTTGCTTTTTCCATTGG + Intronic
1163184290 19:15626946-15626968 CCACACTATCCATTCTCCAGGGG + Intronic
1167350820 19:48973392-48973414 CCCCAATTCCCTTTTTCCATAGG - Intronic
1168432084 19:56289339-56289361 CCAGACTATCACTTTTCCTTTGG - Intronic
925445984 2:3927343-3927365 ACACACTTTTCTTTTTCAATTGG + Intergenic
926307192 2:11646846-11646868 CCTCACTTACCCTTTGCCATGGG - Intergenic
926503354 2:13681375-13681397 CCAGATTGTCCCTTTTCCACTGG + Intergenic
928227040 2:29458962-29458984 CCACACTTTTCCATTTTAATAGG + Intronic
928769364 2:34687936-34687958 CCCCACTCTCCAATTTCCATTGG + Intergenic
930282572 2:49387954-49387976 CCACACTGTTCCTTTTCACTGGG - Intergenic
932056599 2:68449337-68449359 CCACACTTTCCCATTCCCCTCGG + Intergenic
932578326 2:72975246-72975268 CCACACTGCCCCTTTTACACCGG - Intronic
932850764 2:75182601-75182623 CAACACATTACCTTTTCTATGGG + Intronic
933822409 2:86125606-86125628 CTACACTTTACCTTTTCCTGAGG + Intronic
934097525 2:88620284-88620306 CCACACTCCCCCCTTTCCATGGG + Intronic
934296615 2:91747893-91747915 CCCCACTTTCCCTTCTTCAAAGG - Intergenic
934572432 2:95381574-95381596 CCACACTCTCCTTTCCCCATAGG + Exonic
935519368 2:104085070-104085092 CCACCATTCCCCTTTTCCTTTGG + Intergenic
935710430 2:105893405-105893427 TCACATTATTCCTTTTCCATCGG + Exonic
937304369 2:120862162-120862184 CGATAATTTCCCTTTGCCATGGG - Intronic
939604914 2:144242366-144242388 CCACTCTTTACTGTTTCCATGGG + Intronic
940786950 2:157991471-157991493 CCATACTTTCCATTATCCACAGG + Intronic
942816713 2:180060902-180060924 CCCCACTTTGCCTTTTACAAGGG - Intergenic
944011696 2:194981532-194981554 CCAAACTTTTCCTCCTCCATGGG + Intergenic
944933477 2:204544765-204544787 CCACATATTCCCATTTCAATTGG + Intergenic
945049782 2:205812599-205812621 CCACACTTTCCCTCTACAACTGG - Intergenic
945563453 2:211367244-211367266 CCACACTCTCCCTCAACCATGGG + Intergenic
946797743 2:223373608-223373630 CCACACTTTCCATTTATCTTTGG - Intergenic
946931415 2:224675266-224675288 CCACTCTTTCCCTATTTCCTGGG - Intergenic
947389362 2:229623431-229623453 ACACACTATCCCTTTACCAATGG - Intronic
948100530 2:235369513-235369535 CCACACTAGCTCCTTTCCATCGG + Intergenic
948153904 2:235765573-235765595 CCACATGTTCCCTTCTCCCTGGG + Intronic
949017792 2:241723259-241723281 CCACACTCACCATTTTCCTTTGG - Exonic
1168816699 20:742764-742786 CCAAACTTTCCCTCTGCCCTCGG + Intergenic
1172176629 20:32976422-32976444 CCTCACTGTCCCTGTGCCATAGG + Intergenic
1172358989 20:34299193-34299215 CTACACTATCCCTGCTCCATGGG + Intronic
1174442380 20:50566487-50566509 ACACAGTTTCCCTTTGCCCTGGG + Intronic
1176664069 21:9668045-9668067 CCACACTTTCATTTTGCCCTGGG - Intergenic
1177614570 21:23500275-23500297 CCACAATTTCCATGTGCCATGGG - Intergenic
1177785864 21:25670719-25670741 CCACAATTTCCCTTTTCTTTTGG - Intronic
1179835006 21:44025286-44025308 CCAGACTTCCCCTTTGCCACTGG - Intronic
1179918979 21:44496902-44496924 CCAAGCTTTCCCTTTCCCTTTGG - Intergenic
1182396945 22:30043049-30043071 CCACACTTTCATTTTTCACTAGG + Intergenic
1183131006 22:35836032-35836054 GCACACTTTCCACTTTCTATGGG - Intronic
1183474221 22:38026940-38026962 ACACACTTTCCCTCTTGCCTGGG - Intronic
1184062473 22:42091787-42091809 CCAAACTTTCCCATTTCGAAGGG + Intergenic
949338375 3:3002101-3002123 CTACACTCTCCCTATTTCATTGG - Intronic
949632912 3:5948751-5948773 CCACAGTTTCATTTTTCCCTGGG - Intergenic
950692267 3:14669176-14669198 CCACACTCCTCCTTTTCCTTTGG - Intronic
951051727 3:18101392-18101414 CCACACCATCCCTTTTGCTTGGG + Intronic
951057027 3:18159360-18159382 CTCCACATGCCCTTTTCCATGGG + Intronic
952606769 3:35156590-35156612 CCACTCTTTGCCTTTTAAATTGG - Intergenic
955247255 3:57236627-57236649 CAACACTTTCCCTTTTTCAGTGG + Intronic
955545709 3:60027260-60027282 CCACAGTTTTCTTTTTCCTTAGG - Intronic
956877654 3:73479632-73479654 CAAGCCTTTCCCTTTTCCCTTGG + Intronic
960515638 3:118599475-118599497 CTATACTTTGCCTTTTCCAGAGG + Intergenic
961912274 3:130330273-130330295 CCACTCTTCCCTTTTTCCCTTGG - Intergenic
965032928 3:163396678-163396700 CCACACTTTCTCTTTTCAAACGG - Intergenic
965371004 3:167862837-167862859 CCAGTCTTTGCCTTTTCCTTAGG - Intergenic
966134641 3:176684426-176684448 GCTCTCTTTCCCCTTTCCATTGG + Intergenic
968126714 3:196165609-196165631 CCTCAATTTCCCATTTCCTTTGG - Intergenic
968290055 3:197532285-197532307 CCAGCCTGTCCATTTTCCATCGG - Intronic
969433193 4:7168050-7168072 CCAGACTTGCTCTTTTCCCTTGG - Intergenic
969843040 4:9897578-9897600 CCACACTTTCCCTTTTCCATTGG - Intronic
970962487 4:21889180-21889202 TGACACTTTTGCTTTTCCATGGG + Intronic
971004022 4:22353770-22353792 CCACTCTGTGCCTTTTTCATGGG - Intronic
971889309 4:32496823-32496845 CCACATTTTGCCTCTTCCATGGG - Intergenic
973898022 4:55435659-55435681 TCACACTCTCCCCTGTCCATAGG + Intronic
973943123 4:55930587-55930609 ACTCAATTTCCCTATTCCATAGG - Intergenic
974485956 4:62506244-62506266 CCACACCTCTCCTTTTCCTTCGG - Intergenic
975523042 4:75320569-75320591 CCAAACTTTCCCTGTTCCCTAGG + Intergenic
976189859 4:82477564-82477586 CCAGCTTTTCCCTTTTCCAGAGG - Intergenic
978582176 4:110243119-110243141 CAAAATTTTCCTTTTTCCATGGG - Intergenic
979653891 4:123168794-123168816 ACTGAGTTTCCCTTTTCCATAGG - Intronic
979738033 4:124112922-124112944 CCCCACTCACCCTTTTCCATGGG - Intergenic
979932411 4:126647544-126647566 CCACACTTCCCCTTTTCATAAGG - Intergenic
980429568 4:132676063-132676085 CCTCATTTTCCCCTTTTCATTGG - Intergenic
980896910 4:138868924-138868946 CCCTCCTTTCCCTTTTCCTTTGG - Intergenic
984081499 4:175253981-175254003 CCAGATTTTCCCTGTTTCATTGG + Intergenic
985409528 4:189668725-189668747 CCACACTTTCATTTTGCCCTGGG - Intergenic
986162730 5:5245450-5245472 CTATACTTTCCCTTTTCCTTTGG - Intronic
986531422 5:8740497-8740519 CCACGCATTGCCTTTTCCATAGG + Intergenic
988180573 5:27786455-27786477 CCAGACTTCCCCTATCCCATTGG - Intergenic
988794407 5:34639268-34639290 CTACACTTTGCCCTTTCCAAAGG - Intergenic
988885664 5:35555371-35555393 CAACAGTTTACATTTTCCATAGG - Intergenic
991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG + Intergenic
991581800 5:68163277-68163299 CTACTCTTGCCCTTTTCAATTGG + Intergenic
992530037 5:77644885-77644907 CCTCTCATTCTCTTTTCCATCGG + Intergenic
992942648 5:81777578-81777600 ACACACTATCCATTTTCCATGGG - Intergenic
993218058 5:85050734-85050756 CCACTCTGTGCCTTTTACATGGG - Intergenic
993884700 5:93402007-93402029 CCCCAGTTTCGCTTTTCAATAGG + Intergenic
994135417 5:96280999-96281021 CCACATTATTCCTTTGCCATGGG - Intergenic
994293530 5:98060625-98060647 TTACATTTTCCCTTTTACATAGG - Intergenic
997625872 5:135330305-135330327 CCACACTCACCCATTTCCATGGG - Intronic
997798619 5:136837313-136837335 CCACAATTTTCCTTTTCAAGTGG + Intergenic
998165310 5:139839281-139839303 CCACACTTCCTCTTTGCCAGCGG + Intronic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1000243060 5:159426501-159426523 CCACACTTTCCTTCTACCAGGGG - Intergenic
1000699400 5:164429552-164429574 ATACACTTCCCCTTTTCTATTGG - Intergenic
1001116985 5:168948155-168948177 CCACACTTTCCCTTCTCTGCCGG + Intronic
1004051519 6:12085289-12085311 CCACACTGTCCCTTCTCTGTGGG - Intronic
1004206968 6:13600668-13600690 CTTCACTTTCCCTTGTCCCTTGG + Intronic
1004777621 6:18865771-18865793 CTACACTTTCTCTATTCCAAGGG - Intergenic
1006900406 6:37496880-37496902 CCAAACTGTCCACTTTCCATTGG - Intronic
1008425343 6:51349937-51349959 CCTCTCTTTCCCTTATCCCTTGG + Intergenic
1008956838 6:57224741-57224763 CCCCACTTTTCCATTTCCTTGGG + Intergenic
1009568682 6:65351217-65351239 TCACACTGTTTCTTTTCCATTGG + Intronic
1011816785 6:91200968-91200990 CCTCAGTTTCCCTTTTGGATGGG - Intergenic
1013946744 6:115730732-115730754 CCACACTTTCTCCTTCCCAAAGG + Intergenic
1014268725 6:119312464-119312486 CCAAACCTTCACTTATCCATTGG + Intronic
1015174204 6:130288615-130288637 CCACATTTCTCCTTTTACATTGG - Intronic
1015202239 6:130595888-130595910 CTACATTTTCCCTTTTCTCTGGG + Intergenic
1016473303 6:144398134-144398156 CCACGTTTTCCCTGTTCCCTGGG + Intronic
1017455248 6:154595622-154595644 CCTGGCATTCCCTTTTCCATAGG - Intergenic
1018476779 6:164150579-164150601 CCTCTCTTTCCCTTTTGCTTAGG + Intergenic
1018586519 6:165366645-165366667 CCAGACTCTCCCTTCTCAATGGG - Intronic
1018912394 6:168109430-168109452 CCTCACTTTACCTTTTCTATGGG + Intergenic
1019614288 7:1952097-1952119 TCACACTTTCCTTTCTCCCTAGG + Intronic
1019889389 7:3933934-3933956 CCACACCTTCCCCTAGCCATGGG - Intronic
1020508312 7:9020449-9020471 CCCCCCTTTCCCTTTTACAAGGG - Intergenic
1020907015 7:14075898-14075920 GCAGATTTTGCCTTTTCCATTGG - Intergenic
1021748328 7:23767348-23767370 CCAGACTTTCACTCTTCCCTAGG - Intronic
1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG + Intronic
1023115184 7:36855438-36855460 CCACAGCTTCCCTTTACCAAAGG + Exonic
1023235045 7:38076789-38076811 CCACTCTGTGCCTTTTACATGGG + Intergenic
1023630499 7:42159072-42159094 CCACACCTCCCCATTTCTATAGG + Intronic
1027901272 7:84118391-84118413 CCTCAAATTCCCTTTTCTATAGG + Intronic
1028234292 7:88341789-88341811 CAACACATTCCCTTTTGTATAGG - Intergenic
1028300908 7:89199241-89199263 CCAGGCTTTCCCTTTCCCACTGG + Intronic
1030335872 7:108325180-108325202 ACACATTTTCTCTTCTCCATTGG - Intronic
1031044120 7:116868235-116868257 CCGTTTTTTCCCTTTTCCATTGG + Intronic
1031268861 7:119618893-119618915 CAACACTTTCAGTTTTCCAAAGG + Intergenic
1031294618 7:119985371-119985393 CCACACTTTGCCTTTTAATTGGG - Intergenic
1031653592 7:124323227-124323249 CCTAACTTTCTCTTTTCCCTAGG + Intergenic
1031892856 7:127315097-127315119 CCACTCTGTGCCTTTTACATGGG - Intergenic
1032890200 7:136186321-136186343 ACACACTTTCCATTTACAATGGG - Intergenic
1034630862 7:152529610-152529632 CCATCCTTTCCCTTTTCTTTAGG + Intergenic
1035409950 7:158631552-158631574 CCACCCTTTCCCTATTATATGGG + Intronic
1036930110 8:12948088-12948110 CAACACTTTCCATTTACAATGGG - Intronic
1038345038 8:26724940-26724962 CCACACTCTCCCTTCTGCAGTGG - Intergenic
1038696596 8:29812228-29812250 CCACAATCTCCCTGTTCCCTGGG + Intergenic
1043623226 8:82224087-82224109 CTACACTTTCCTACTTCCATAGG - Intergenic
1046014276 8:108587060-108587082 TCACACTTTCTCCTTTCCAAGGG + Intergenic
1046378697 8:113422705-113422727 TCACACTGTCACTTTTCCAGTGG - Intronic
1046578775 8:116065682-116065704 CCAATCTCTCTCTTTTCCATGGG - Intergenic
1046753791 8:117952810-117952832 CCCCACTTTCAGTTTTGCATTGG + Intronic
1048508635 8:135042836-135042858 CCAAACTTTCCCCTTTTCAAGGG + Intergenic
1050025560 9:1331204-1331226 CCAAACTTCCCCTTTTTAATAGG - Intergenic
1050189623 9:3010968-3010990 TGACACTTTCTATTTTCCATTGG - Intergenic
1051160653 9:14204006-14204028 CAACACTTTCCCATTTGCAATGG + Intronic
1051552846 9:18349678-18349700 ACACATTTACCCATTTCCATCGG + Intergenic
1051851661 9:21516459-21516481 CCCCACCTTCCCTTTTCAGTGGG - Intergenic
1055589869 9:77801045-77801067 CCACACTTTCCCTTTACCTCAGG - Intronic
1057713259 9:97466318-97466340 CCACCCTTTCCCATTTGCAGAGG + Intronic
1058102061 9:100927207-100927229 CCACTTTTTCCCATCTCCATAGG - Intergenic
1059893743 9:118836015-118836037 CCACAATTTCCATGTTTCATGGG + Intergenic
1203662031 Un_KI270753v1:53707-53729 CCACACTTTCATTTTGCCCTGGG + Intergenic
1185928088 X:4169894-4169916 TTAAACTTTCCATTTTCCATTGG + Intergenic
1186447957 X:9647976-9647998 TCACACTCTCCCCTTTACATAGG + Intronic
1186475794 X:9856787-9856809 CCACCCTTTCCCTTTTCTTCTGG - Intronic
1190935089 X:54992766-54992788 CCACTCTTGGCCTTTTCCAAGGG - Intronic
1191595810 X:62943273-62943295 CCACAATTTCCATGTGCCATGGG - Intergenic
1191798330 X:65048073-65048095 CCACATTTCCCCGTTTCCCTGGG + Intergenic
1193644663 X:84052968-84052990 CCACAATTCCCATGTTCCATGGG + Intergenic
1193956761 X:87873345-87873367 CTAAACTTTCCCCTGTCCATTGG - Intergenic
1194023593 X:88723980-88724002 CCACTCTTTCCTTTTTCCAAAGG - Intergenic
1196328623 X:114439574-114439596 TAACACTTTCCCTTATACATAGG + Intergenic
1197806261 X:130401441-130401463 CTGCACTTACTCTTTTCCATAGG - Intergenic
1198963523 X:142205494-142205516 CCCCACTCTCCTTTTTCCAGGGG + Intergenic
1199115391 X:143985988-143986010 CCATCCCTTCCTTTTTCCATGGG + Intergenic
1199878185 X:151951673-151951695 ACACACTTTCACATTTTCATAGG - Intergenic
1199943217 X:152644288-152644310 CCACACTTTCACTTATGCATGGG + Intronic
1201492403 Y:14556708-14556730 CCTCTTTTTCCCTTTTCTATGGG + Intronic
1201857677 Y:18563366-18563388 CCACAGATTCCCCTGTCCATGGG + Intronic
1201875644 Y:18757015-18757037 CCACAGATTCCCCTGTCCATGGG - Intronic