ID: 969845413

View in Genome Browser
Species Human (GRCh38)
Location 4:9916656-9916678
Sequence CCCAGGGAAGTGACTATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969845407_969845413 5 Left 969845407 4:9916628-9916650 CCCCATTTTTCAGGATGGGAGAC 0: 1
1: 0
2: 1
3: 41
4: 387
Right 969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG No data
969845408_969845413 4 Left 969845408 4:9916629-9916651 CCCATTTTTCAGGATGGGAGACT 0: 1
1: 0
2: 2
3: 45
4: 455
Right 969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG No data
969845409_969845413 3 Left 969845409 4:9916630-9916652 CCATTTTTCAGGATGGGAGACTG 0: 1
1: 1
2: 1
3: 63
4: 545
Right 969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969845413 Original CRISPR CCCAGGGAAGTGACTATGAT TGG Intronic
No off target data available for this crispr