ID: 969847648

View in Genome Browser
Species Human (GRCh38)
Location 4:9931872-9931894
Sequence CCACATGGAGAGTGACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969847644_969847648 2 Left 969847644 4:9931847-9931869 CCACTTGAGTTGGTGGGGCTTGA 0: 1
1: 0
2: 0
3: 20
4: 402
Right 969847648 4:9931872-9931894 CCACATGGAGAGTGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969847648 Original CRISPR CCACATGGAGAGTGACTGCA GGG Intronic
No off target data available for this crispr