ID: 969851616 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:9961823-9961845 |
| Sequence | TCTAATATCCAGAGTCTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 11925 | |||
| Summary | {0: 5, 1: 262, 2: 1831, 3: 5135, 4: 4692} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 969851613_969851616 | 24 | Left | 969851613 | 4:9961776-9961798 | CCTACAGAATGGAAGAAAATTTT | 0: 257 1: 9645 2: 15596 3: 11258 4: 7596 |
||
| Right | 969851616 | 4:9961823-9961845 | TCTAATATCCAGAGTCTAGAAGG | 0: 5 1: 262 2: 1831 3: 5135 4: 4692 |
||||
| 969851615_969851616 | -9 | Left | 969851615 | 4:9961809-9961831 | CCATCTGACAGAGGTCTAATATC | 0: 36 1: 1161 2: 5591 3: 3320 4: 1571 |
||
| Right | 969851616 | 4:9961823-9961845 | TCTAATATCCAGAGTCTAGAAGG | 0: 5 1: 262 2: 1831 3: 5135 4: 4692 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 969851616 | Original CRISPR | TCTAATATCCAGAGTCTAGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||