ID: 969851616

View in Genome Browser
Species Human (GRCh38)
Location 4:9961823-9961845
Sequence TCTAATATCCAGAGTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11925
Summary {0: 5, 1: 262, 2: 1831, 3: 5135, 4: 4692}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969851613_969851616 24 Left 969851613 4:9961776-9961798 CCTACAGAATGGAAGAAAATTTT 0: 257
1: 9645
2: 15596
3: 11258
4: 7596
Right 969851616 4:9961823-9961845 TCTAATATCCAGAGTCTAGAAGG 0: 5
1: 262
2: 1831
3: 5135
4: 4692
969851615_969851616 -9 Left 969851615 4:9961809-9961831 CCATCTGACAGAGGTCTAATATC 0: 36
1: 1161
2: 5591
3: 3320
4: 1571
Right 969851616 4:9961823-9961845 TCTAATATCCAGAGTCTAGAAGG 0: 5
1: 262
2: 1831
3: 5135
4: 4692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969851616 Original CRISPR TCTAATATCCAGAGTCTAGA AGG Intronic
Too many off-targets to display for this crispr