ID: 969854420

View in Genome Browser
Species Human (GRCh38)
Location 4:9987708-9987730
Sequence AAACCAGCCTCTCGGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969854420 Original CRISPR AAACCAGCCTCTCGGGAGAC TGG Intronic
900930121 1:5731181-5731203 AAAACAGCCTCTCAGAAGCCGGG + Intergenic
901735882 1:11311874-11311896 CAACCATCCTCTCAGAAGACAGG - Intergenic
902514447 1:16982488-16982510 AACCCAGCCTCTCGGGTAGCTGG + Intergenic
902533794 1:17107323-17107345 CAGCCAGCCTCTCCAGAGACTGG - Intronic
903632874 1:24790187-24790209 ATCCCAGCCACTCGGGAGGCTGG - Intronic
903961691 1:27061892-27061914 AACCCAGCGTCTTGGGTGACTGG + Intergenic
905393636 1:37653434-37653456 ACACCAGCCTCTCGGGGGCCTGG - Intergenic
905446671 1:38032086-38032108 ATCCCAGCCACTCGGGAGGCTGG + Intergenic
908678468 1:66632520-66632542 ATCCCAGCTTCTCGGGAGGCTGG + Intronic
909950987 1:81720292-81720314 AATCCAGCTACTCGGGAGGCTGG - Intronic
912467610 1:109884732-109884754 AAACCAACTTCTAGGGAAACCGG + Intergenic
920181589 1:204135123-204135145 CAACCAGCCTCCCAGGAGAGAGG - Intronic
921999923 1:221466707-221466729 ATCCCAGCCACTCGGGAGGCTGG - Intergenic
922287312 1:224181623-224181645 ATCCCAGCTCCTCGGGAGACTGG + Intronic
923348122 1:233077396-233077418 AAAACAGCCTCTTGGAAAACAGG + Intronic
924167487 1:241299995-241300017 ATACCAGCCACTCGGGAGGCTGG + Intronic
924258134 1:242202882-242202904 AAACCAGCCTGTGGGGATGCAGG + Intronic
924314514 1:242782009-242782031 ATCCCAGCTACTCGGGAGACCGG + Intergenic
924544956 1:245018255-245018277 AAACCATCCTTTCAGGAGGCCGG + Intronic
1064712353 10:18140506-18140528 AAGCGAGCCGCTCGGGAGGCGGG - Intergenic
1065347138 10:24759445-24759467 ATCCCAGCTTCTCGGGAGGCTGG - Intergenic
1065732498 10:28722321-28722343 AACTCAGCCTCTGGGCAGACCGG + Intergenic
1067153056 10:43752210-43752232 AAACCAGAATCTGGGGAGAAAGG - Intergenic
1067907184 10:50304890-50304912 GTCCCAGCCTCTCAGGAGACAGG - Intergenic
1068090736 10:52429628-52429650 AAACCAGAATCTCCGGAGATGGG + Intergenic
1068224632 10:54091304-54091326 ACACCAGCCTCTCCACAGACAGG + Intronic
1069480881 10:68781112-68781134 ATACCAGCTACTCGGGAGGCTGG + Intronic
1072676725 10:97472353-97472375 ATCCCAGCCACTCGGGAGACAGG - Intronic
1075030959 10:119024511-119024533 ATCCCAGCCACTCGGGAGGCTGG + Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1078245670 11:9572187-9572209 ATACCAGCTACCCGGGAGACAGG + Intergenic
1079022331 11:16919422-16919444 ATCCCAGCTTCTCAGGAGACAGG + Intronic
1081422748 11:42891018-42891040 CAGCCAGCCTCAAGGGAGACAGG - Intergenic
1084035276 11:66506064-66506086 ATACCAGCTACTCGGGAGACTGG - Intronic
1084196619 11:67526323-67526345 ATACCAGCTACTCGGGAGGCTGG + Intergenic
1084997717 11:72998422-72998444 ATCCCAGCCACTCAGGAGACTGG + Intronic
1085787459 11:79467190-79467212 ATACCAGCCACTCAGGAGGCTGG - Intergenic
1086154790 11:83653838-83653860 ATACCAGCTACTCGGGAGGCTGG - Intronic
1089388264 11:118082037-118082059 AGACCCTCCTCTCTGGAGACTGG - Intronic
1089574588 11:119432436-119432458 AGGCCAGCCCCTCGGGAGAAGGG - Intergenic
1089646097 11:119880133-119880155 ACAGCTGCGTCTCGGGAGACAGG + Intergenic
1090592930 11:128291442-128291464 AATCCAGCCTCCCTGGATACTGG + Intergenic
1093177195 12:15925937-15925959 AATCCAGCTACTCGGGAGGCAGG - Intronic
1095458331 12:42414150-42414172 ATCCCAGCTACTCGGGAGACAGG - Intronic
1095988489 12:48016937-48016959 AAACCAGCCTCTCGGGAAATGGG + Intergenic
1098253628 12:68594256-68594278 ATACCAGCCACTCGGGAGGCTGG - Intergenic
1098539936 12:71643293-71643315 ATCCCAGCTACTCGGGAGACTGG + Intronic
1100813850 12:98366555-98366577 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1105366923 13:19773768-19773790 AACCCAGCTACTCGGGAGGCAGG - Intronic
1106675557 13:31954374-31954396 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1107399356 13:40054001-40054023 TAACCAGCCGCAAGGGAGACTGG - Intergenic
1111633006 13:90867164-90867186 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1111742879 13:92226714-92226736 ATCCCAGCTGCTCGGGAGACTGG - Intronic
1113596652 13:111538544-111538566 ACCCCAGCCCCTTGGGAGACTGG + Intergenic
1115902140 14:38163785-38163807 ATACCAGCTTCTCAGGAGGCTGG - Intergenic
1118747374 14:68784168-68784190 AAACCAGACTCTGAGGAGCCAGG - Intergenic
1119243660 14:73084668-73084690 ATCCCAGCTTCTCGGGAGGCTGG - Intronic
1119841227 14:77794641-77794663 GAGCCAGCCTCTGGGGAGCCAGG + Intergenic
1121933288 14:97993150-97993172 AAACCAGTCTCTCTGGGGCCAGG + Intergenic
1125616188 15:41015827-41015849 ATCCCAGCTACTCGGGAGACTGG + Intronic
1125807260 15:42504222-42504244 ATCCCAGCTACTCGGGAGACTGG + Intronic
1127137666 15:55941679-55941701 ATACCAGCTACTTGGGAGACTGG - Intronic
1128263306 15:66247915-66247937 AATCCAGCCACTCGGGAGGCTGG + Intronic
1130534841 15:84776932-84776954 ATCCCAGCTACTCGGGAGACTGG + Intronic
1131084679 15:89566427-89566449 AAAGCAGCTTCTCCGGAGAGTGG - Intergenic
1131721383 15:95172307-95172329 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1132475580 16:135489-135511 AACCCAGCTACTCGGGAGGCTGG + Intronic
1136347093 16:29683140-29683162 ATCCCAGCTACTCGGGAGACTGG - Intronic
1140039882 16:71399451-71399473 AACCCAGCTACTCGGGAGGCTGG - Intergenic
1140055363 16:71521181-71521203 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1140685002 16:77425127-77425149 AACCCAGGCTCTCTGGAGAATGG + Intronic
1141302740 16:82833137-82833159 ACACAAGGCTCTTGGGAGACGGG - Intronic
1142977273 17:3653113-3653135 AGACCTGCCTCTCGGAAGGCCGG + Intronic
1146722870 17:35135427-35135449 ACACCAGCCTCTCTGGACCCTGG + Exonic
1150822439 17:68446293-68446315 ACCCCAGCCTCTCGGGTGGCAGG + Intronic
1151367157 17:73625139-73625161 AACACAGCCTCTCATGAGACAGG + Intronic
1152763582 17:82122621-82122643 AAGCAAGCCTGGCGGGAGACAGG - Intronic
1153708765 18:7775568-7775590 AGCCCAGCCTCTCTGGACACAGG - Intronic
1157880207 18:51314351-51314373 AAACCAGATTCTCTGGGGACAGG - Intergenic
1158353654 18:56592050-56592072 AGACCAGCCTATCAGGAGAATGG + Intergenic
1161044165 19:2126092-2126114 ACACCAGCCTCAAGAGAGACGGG + Intronic
1161108006 19:2454173-2454195 ATCCCAGCTACTCGGGAGACGGG + Intronic
1162146077 19:8612669-8612691 AACCCAGCTACTCGGGAGGCTGG - Intergenic
1163149809 19:15404389-15404411 AAGGCAGACTCTTGGGAGACTGG - Intronic
1165417287 19:35702623-35702645 AGACAAGCACCTCGGGAGACTGG + Intergenic
1167039198 19:47012498-47012520 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1167685162 19:50951388-50951410 ATCCCAGCTACTCGGGAGACTGG - Intronic
927310654 2:21627461-21627483 ATCCCAGCCACTCGGGAGGCAGG - Intergenic
928649613 2:33390603-33390625 GTCCCAGCTTCTCGGGAGACTGG - Intronic
928967005 2:36986732-36986754 ATCCCAGCTACTCGGGAGACTGG - Intronic
930058996 2:47273018-47273040 AAACCAGCCTTTCGCGACCCTGG - Intergenic
931772494 2:65510272-65510294 AACCCAGCTACTCGGGAGGCTGG - Intergenic
932114001 2:69028724-69028746 AAACCAGTCTGTCGTGAGAAAGG + Intronic
933715510 2:85356761-85356783 ATTCCAGCTACTCGGGAGACTGG + Intronic
933740087 2:85526452-85526474 ATCCCAGCTACTCGGGAGACTGG - Intergenic
934475901 2:94593277-94593299 AAAGGAGCCTCTGGGGAGGCAGG + Intronic
934589798 2:95536920-95536942 ATCCCAGCCACTCAGGAGACTGG + Intergenic
934930649 2:98419915-98419937 AAATCAGCATCTCTGAAGACGGG - Intergenic
935034485 2:99355728-99355750 ATCCCAGCTACTCGGGAGACTGG - Intronic
935182934 2:100706330-100706352 AAACCAGACACTCTGGAGCCGGG + Intergenic
937262942 2:120597990-120598012 CACCCAGCCACTAGGGAGACTGG - Intergenic
937373814 2:121321553-121321575 AAAGCTGTTTCTCGGGAGACTGG - Intergenic
937983937 2:127630168-127630190 AGACCAGCCTCTCCGGAGGCAGG + Intronic
940542528 2:155039482-155039504 ATTCCAGCTACTCGGGAGACAGG + Intergenic
940881655 2:158953034-158953056 ATCCCAGCTACTCGGGAGACTGG - Intergenic
941828485 2:169926469-169926491 ATCCCAGCTACTCGGGAGACTGG + Intronic
942698059 2:178668612-178668634 ATCCCAGCCACTCGGGAGGCTGG + Intronic
943379058 2:187120233-187120255 AATCCAGCTACTCGGGAGGCTGG + Intergenic
944577497 2:201103645-201103667 AACCCAGCTACTCGGGAGGCTGG - Intergenic
947968520 2:234302394-234302416 AAACCAGCCTCTGGGGCGCTTGG - Intergenic
1172620865 20:36317706-36317728 AAACCAGCAACTGGGGAGGCTGG - Intronic
1172844811 20:37923591-37923613 ATACCAGCCTCCCTGGGGACTGG + Intronic
1172992433 20:39046512-39046534 AACTCAGCTTCTAGGGAGACAGG + Intergenic
1173442158 20:43087476-43087498 ACATCAGCCTCTCGAGAGGCTGG + Intronic
1174751542 20:53115998-53116020 AAACCAAGCTATCGTGAGACAGG + Intronic
1175839082 20:62015209-62015231 GAACCCTCCTCTCGGGAGGCAGG + Intronic
1176079252 20:63263558-63263580 ATCCCAGCTACTCGGGAGACAGG + Intronic
1178439871 21:32590120-32590142 AAATCAGCTAGTCGGGAGACTGG + Intronic
1179725955 21:43341346-43341368 AACCCAGCTCCTGGGGAGACAGG + Intergenic
1179830191 21:43991780-43991802 AAACCAGCTCCTAGGGAGTCGGG - Intergenic
1181091441 22:20475679-20475701 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1181150999 22:20883473-20883495 GAACCAGCCCCTCTGGGGACAGG - Exonic
1182311498 22:29411994-29412016 ACACCATACTCTCGGCAGACAGG - Intronic
1182919857 22:34069343-34069365 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1183336862 22:37253777-37253799 ATCCCAGCAACTCGGGAGACTGG - Intergenic
1184241098 22:43211632-43211654 ATCCCAGCTACTCGGGAGACTGG - Intronic
1184772988 22:46608893-46608915 AACTCAGCCTCTGGGGAGGCTGG - Intronic
950570669 3:13798076-13798098 ATCCCAGCTACTCGGGAGACAGG + Intergenic
950765507 3:15270150-15270172 AAACCAGCCCATCGTGGGACAGG + Intronic
950902210 3:16508151-16508173 GAACCAGCCTCACAGGAGAGAGG - Intronic
952409767 3:33037161-33037183 ATTCCAGCTACTCGGGAGACTGG - Intronic
954243492 3:49312369-49312391 ATCCCAGCCACTCGGGAGGCTGG + Intronic
954354334 3:50072290-50072312 ATCCCAGCTACTCGGGAGACTGG + Intronic
955307790 3:57851588-57851610 ATTCCAGCTACTCGGGAGACTGG - Intronic
956606289 3:71076153-71076175 AAGCCAGCCTTTCTGGAGACAGG - Intronic
957192563 3:77028600-77028622 ATCCCAGCTTCTCGGGAGGCTGG + Intronic
959239833 3:103775936-103775958 ATTCCAGCCACTCGGGAGGCTGG + Intergenic
960458126 3:117899183-117899205 AAGACAGCCTCTGGGGAGAGAGG + Intergenic
962899018 3:139740977-139740999 AACCCAACCTCGCTGGAGACAGG + Intergenic
966376855 3:179305121-179305143 ATCCCAGCTACTCGGGAGACAGG - Intergenic
967518533 3:190400348-190400370 ATCCCAGCCACTCGGGAGGCAGG - Intronic
968041626 3:195594013-195594035 AACCCTGCTACTCGGGAGACTGG + Intergenic
968045173 3:195619911-195619933 GACCCAGCCTCTATGGAGACCGG - Intergenic
968061025 3:195726254-195726276 GACCCAGCCTCTATGGAGACCGG - Exonic
969694611 4:8727631-8727653 AGCCCAGGCTTTCGGGAGACAGG + Intergenic
969854420 4:9987708-9987730 AAACCAGCCTCTCGGGAGACTGG + Intronic
970986640 4:22166695-22166717 ATCCCAGCTACTCGGGAGACTGG - Intergenic
973993196 4:56432408-56432430 ATCCCAGCTACTCGGGAGACAGG + Intronic
977083277 4:92560822-92560844 ATCCCAGCCACTTGGGAGACTGG - Intronic
978101606 4:104848367-104848389 ATCCCAGCTACTCGGGAGACTGG - Intergenic
978533833 4:109740171-109740193 ATCCCAGCTACTCGGGAGACTGG + Intergenic
982011434 4:151109541-151109563 ATCCCAGCCTCTCAGGAGGCTGG - Intronic
982909953 4:161127688-161127710 ATCCCAGCCACTCGGGAGACAGG - Intergenic
985263812 4:188139759-188139781 AAACGAGCGTCTGGGGAGGCTGG + Exonic
986348553 5:6856295-6856317 ACCCCAGCCACTCGGGAGACTGG + Intergenic
988685592 5:33522283-33522305 AAACCAGCCCCTGGGGACAAAGG - Intergenic
989019409 5:36984744-36984766 AGACCAGCTTCTCAGGAGACGGG + Exonic
989362085 5:40613274-40613296 AAACCAGAATCTCTGGACACAGG - Intergenic
990266259 5:54079850-54079872 ATACCAGCCACTCAGGAGGCTGG + Intronic
990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG + Intronic
994029890 5:95129776-95129798 ATCCCAGCTACTCGGGAGACTGG - Intronic
995672776 5:114625619-114625641 AATCCAGCCCCTAGGGAGAAGGG + Intergenic
995720906 5:115131859-115131881 TTACCAGCCTCTGGGGAGAGGGG + Intronic
996089890 5:119340411-119340433 CAACCAGCCTCCCGGGAGCAGGG - Intronic
999459736 5:151747704-151747726 ATCCCAGCCACTCGGGAGGCTGG - Intronic
999459885 5:151748741-151748763 ATCCCAGCTTCTCGGGAGGCTGG + Intronic
1000753887 5:165132504-165132526 ATACCAGCTACTCGGGAGGCTGG + Intergenic
1001196053 5:169674502-169674524 AAACAAGCTTCTGGGGAGAGAGG - Intronic
1001809020 5:174612903-174612925 AGGCCAGCCTCCCTGGAGACAGG - Intergenic
1002063265 5:176639236-176639258 GAACCAGCTTCTCTGGAGTCAGG + Intronic
1005736376 6:28751543-28751565 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1006318113 6:33302761-33302783 ATCCCAGCTACTCGGGAGACTGG - Intronic
1006542469 6:34751668-34751690 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1007419145 6:41708836-41708858 AGACCAGTCACTGGGGAGACTGG + Intronic
1007551210 6:42731366-42731388 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1007603909 6:43102469-43102491 ATACCAGCTACTTGGGAGACTGG + Intronic
1009292272 6:61897218-61897240 AAACCACAATCTCTGGAGACAGG + Intronic
1017063112 6:150505054-150505076 ACACCAGCCTCTGTGGACACGGG - Intergenic
1018188674 6:161289604-161289626 AATCCAGCTACTCGGGAGGCTGG + Intergenic
1018742833 6:166743754-166743776 AAACCAGGCCCACGGCAGACAGG + Intronic
1019664951 7:2247202-2247224 GAACCAGCCTCCCCAGAGACCGG - Intronic
1020481264 7:8664543-8664565 AATCCAGCATCTCTGGAGAATGG - Intronic
1020826360 7:13034311-13034333 AAACCAATGTCTGGGGAGACTGG + Intergenic
1022100864 7:27168442-27168464 CAACCAGCCTCGCTGGAGCCTGG - Intronic
1023443790 7:40211090-40211112 ATACCAGCTACTCGAGAGACAGG - Intronic
1023967752 7:44971839-44971861 AATCAAGCCTCAAGGGAGACAGG - Intronic
1024524097 7:50333422-50333444 AAAGCAGCCGCTCTGGAGATTGG + Intronic
1026963881 7:74427068-74427090 AACCCAGCTTCTCAGGAGAAGGG - Intergenic
1027126215 7:75558453-75558475 AACCCAGCTACTCAGGAGACTGG - Intronic
1029975448 7:104828915-104828937 ATCCCAGCTTCTCGGGAGGCTGG + Intronic
1030262329 7:107579251-107579273 ATCCCAGCCACTCTGGAGACTGG + Intergenic
1032132034 7:129237833-129237855 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1033288882 7:140064430-140064452 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1033409985 7:141108662-141108684 AAACCTGCCTGCCGGGATACTGG - Intronic
1034443866 7:151101781-151101803 AAGCCAGGGTCTCGGGAGGCCGG + Intronic
1034979506 7:155467162-155467184 AAATCAGCCTCCGGGGAGATGGG + Intergenic
1038157422 8:25003019-25003041 AAATCAGCCTGTCTGGATACAGG - Intergenic
1039643967 8:39259315-39259337 ATACCAGCTTCTGGGGAGGCTGG - Intronic
1039870830 8:41543821-41543843 ATACCAGCTACTCGGGAGGCTGG - Exonic
1040519440 8:48162577-48162599 ATATCAGCTACTCGGGAGACTGG - Intergenic
1048384094 8:133895107-133895129 ATTCCAGCCTCTCTGAAGACTGG - Intergenic
1048559953 8:135524131-135524153 ATCCCAGCTACTCGGGAGACTGG - Intronic
1050985079 9:12071947-12071969 ATCCCAGCTCCTCGGGAGACTGG - Intergenic
1052854150 9:33396642-33396664 AAAGGAGCCTCTGGGGAGGCAGG - Intronic
1053682163 9:40492807-40492829 AAAGGAGCCTCTGGGGAGGCAGG - Intergenic
1053932150 9:43121130-43121152 AAAGGAGCCTCTGGGGAGGCAGG - Intergenic
1054281551 9:63132122-63132144 AAAGGAGCCTCTGGGGAGGCAGG + Intergenic
1054295260 9:63328310-63328332 AAAGGAGCCTCTGGGGAGGCAGG - Intergenic
1054393279 9:64632811-64632833 AAAGGAGCCTCTGGGGAGGCAGG - Intergenic
1054502450 9:65883520-65883542 AAAGGAGCCTCTGGGGAGGCAGG + Intronic
1055447484 9:76397162-76397184 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1060562929 9:124561792-124561814 ATACCAGCTACTCGGGAGGCTGG + Intronic
1061408937 9:130407888-130407910 AAACCAGCCTCTCTGGGGTGAGG + Intronic
1061506956 9:131036881-131036903 AAACCAGGCTGTCTGGGGACAGG - Intronic
1061563717 9:131423349-131423371 AAACTAGCCTATCCGGAGGCAGG - Intronic
1185541413 X:905708-905730 AACCCAGCTACTCGGGAGGCTGG + Intergenic
1187447634 X:19373039-19373061 AAAGGAGCCTCCCAGGAGACAGG + Intronic
1187699843 X:21954952-21954974 ATACCAGCTACTCGGGAGGCTGG - Intronic
1187897426 X:23995863-23995885 ATCCCAGCTACTCGGGAGACAGG - Intronic
1188039405 X:25354471-25354493 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1189239860 X:39516757-39516779 ACACCAGCCTCTCGGGGGCCGGG + Intergenic
1189549526 X:42078531-42078553 ATTCCAGCCACTCGGGAGGCTGG - Intergenic
1190021518 X:46882502-46882524 AATCCAGTCTCTCTAGAGACAGG - Intergenic
1190649438 X:52555152-52555174 AAACAGGCCTCTGGGGAGAAAGG - Intergenic
1190692297 X:52921510-52921532 AAGGCAGCCTCGCGGGAAACAGG - Intergenic
1191163721 X:57364722-57364744 ATACCAGCATCTTGGGACACAGG - Intronic
1192176963 X:68892383-68892405 AAACCAGCCCCTGGGGAGGCTGG - Intergenic
1192575580 X:72240680-72240702 ATCCCAGCTTCTCGGGAGGCTGG + Intronic
1199158980 X:144585924-144585946 ATTCCAGCCTCACAGGAGACAGG - Intergenic
1200119563 X:153783961-153783983 AAGCCAGAGTCTGGGGAGACGGG - Exonic
1201478600 Y:14411997-14412019 AAAACAGCTTCTCTGGAGAGAGG - Intergenic
1201775712 Y:17663552-17663574 AAAACAGCTACTTGGGAGACTGG - Intergenic
1201825844 Y:18242440-18242462 AAAACAGCTACTTGGGAGACTGG + Intergenic