ID: 969854769

View in Genome Browser
Species Human (GRCh38)
Location 4:9990365-9990387
Sequence GCTGCTGTGTTGGGTGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969854761_969854769 24 Left 969854761 4:9990318-9990340 CCTTCCATTTATCCAACAAATGT 0: 1
1: 2
2: 21
3: 133
4: 768
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257
969854760_969854769 28 Left 969854760 4:9990314-9990336 CCATCCTTCCATTTATCCAACAA 0: 1
1: 0
2: 18
3: 412
4: 2835
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257
969854762_969854769 20 Left 969854762 4:9990322-9990344 CCATTTATCCAACAAATGTCTAC 0: 1
1: 0
2: 4
3: 57
4: 378
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257
969854763_969854769 12 Left 969854763 4:9990330-9990352 CCAACAAATGTCTACTGCTTGCC 0: 1
1: 0
2: 2
3: 12
4: 156
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257
969854764_969854769 -9 Left 969854764 4:9990351-9990373 CCTGCTGTGTACAAGCTGCTGTG 0: 1
1: 0
2: 7
3: 32
4: 336
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257
969854759_969854769 29 Left 969854759 4:9990313-9990335 CCCATCCTTCCATTTATCCAACA 0: 1
1: 0
2: 11
3: 107
4: 764
Right 969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG 0: 1
1: 0
2: 0
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969854769 Original CRISPR GCTGCTGTGTTGGGTGCTAG GGG Intronic
900061890 1:693187-693209 GCTTCTGTGTTGGCTCCTCGAGG - Intergenic
900832981 1:4978367-4978389 GCTGCTTTTCTGGGTGCCAGTGG + Intergenic
902232573 1:15037046-15037068 GATGCTGTGCTGAGTGCCAGGGG - Intronic
902711597 1:18243685-18243707 GCTGGTGTGGTGGGAGGTAGTGG - Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904238264 1:29127784-29127806 GCAGATGTGTGGGCTGCTAGTGG + Intergenic
904338253 1:29811842-29811864 TATTCTGTGTTGTGTGCTAGGGG + Intergenic
906807802 1:48796241-48796263 GAAGAAGTGTTGGGTGCTAGTGG - Intronic
907469695 1:54665298-54665320 GCTGCTGGGCTGGGGGGTAGGGG - Intronic
907810859 1:57868394-57868416 TCTGCTGTTTTGGTTGCCAGAGG + Intronic
908536156 1:65079424-65079446 GCTATGGTCTTGGGTGCTAGAGG - Intergenic
909203585 1:72725285-72725307 GCTGCTGTGTAGGGAGGGAGTGG - Intergenic
912635284 1:111286187-111286209 GCTGCAGGCTTGGGTGCTGGTGG - Intergenic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
914938856 1:152004296-152004318 GCTGCTGGGCTGGGTGCTGTGGG + Intergenic
915307402 1:154988509-154988531 GCTGCTGCGGCGGGTGCTGGAGG + Exonic
915649660 1:157300222-157300244 GCTGGGGGGTGGGGTGCTAGAGG + Intergenic
916140068 1:161689121-161689143 GATGCTGTTTTGGGTGGTGGTGG + Intergenic
918071401 1:181135578-181135600 ACTGCTGGGTGGGGTTCTAGGGG + Intergenic
918250242 1:182696927-182696949 TCTGCTGGCTAGGGTGCTAGGGG + Intergenic
919561405 1:199124611-199124633 CCTGCAGTGTTGGCTGCTAATGG - Intergenic
920191118 1:204194506-204194528 GGTGCTGTGCTAGGTGCTAGGGG + Intronic
920828529 1:209445227-209445249 GCTGCTGTGGTGGGTGCTGCTGG - Intergenic
920952816 1:210588115-210588137 GCTGCTGTGTTAGGGGACAGTGG + Intronic
920964068 1:210687818-210687840 GCTGCTGTGGCTGGTGCTGGTGG - Intronic
922339004 1:224640696-224640718 GCTGCTGTGTTGTGAACTGGTGG + Intronic
922645545 1:227282499-227282521 GCTGCTGCAGTGTGTGCTAGAGG - Intronic
923360232 1:233203912-233203934 CATGCTGTGTTGGGTACAAGTGG - Intronic
923448472 1:234094471-234094493 GAGGCTGTCTTGGGTGCTACAGG + Intronic
923665179 1:235993025-235993047 GCTGCTGTCCTGGGGGCCAGGGG - Intronic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1067057783 10:43062287-43062309 CCTGCTGTGCTGTGGGCTAGAGG - Intergenic
1067659355 10:48222814-48222836 GCTGCTGAGTTGTGTGTTGGGGG + Intronic
1067804336 10:49382705-49382727 GCTGGTGTGTTGGGTGCCTATGG - Intronic
1069800227 10:71077359-71077381 ACTGCTGTTTTGGGAGCCAGTGG - Intergenic
1071502649 10:86214545-86214567 TGTGCTGTGCTGGGTGCTGGGGG - Intronic
1072661301 10:97365145-97365167 GCTGGTGAGTTGGGTGCATGTGG + Intronic
1072922025 10:99584466-99584488 GCAGCTGTGTCGGGAGCTCGGGG + Intergenic
1074901194 10:117817641-117817663 GCGGCTGAGGTGGGTCCTAGAGG + Intergenic
1075892222 10:125962238-125962260 GCAGCTATGGTGGGTGCAAGGGG - Intronic
1076027993 10:127132619-127132641 GCTGTTGTGTTGTGTGCAGGTGG + Intronic
1076157634 10:128215917-128215939 GCTGCTGTGTTAGGTGGGATCGG + Intergenic
1076368091 10:129935222-129935244 GCTGCTGTGACAGGTGCGAGTGG - Intronic
1076966733 11:94439-94461 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1076978711 11:193958-193980 GGTGCTGTGTTGGGTGGTCTTGG - Intronic
1077552512 11:3207262-3207284 GCTGCTGTGCTGAGAGGTAGTGG - Intergenic
1077804450 11:5576144-5576166 TCTGCTGTATTGGGTCTTAGAGG + Intronic
1079158197 11:17968380-17968402 GGTGCTGTCCTAGGTGCTAGGGG + Intronic
1079734208 11:23975075-23975097 GGTGCTGGGTTGGGTGAAAGGGG + Intergenic
1080410961 11:32024489-32024511 GATGCTGTGCTGGATACTAGAGG - Intronic
1080941053 11:36918557-36918579 GCTCCTGTGTTGGGTGACAGTGG - Intergenic
1083733898 11:64668825-64668847 CCTGCTGAGTTGGGGGCCAGAGG - Intronic
1084918560 11:72450328-72450350 GCCACCATGTTGGGTGCTAGGGG + Intergenic
1084961904 11:72721287-72721309 GGTGCTGTGGTGGGTGCTTATGG - Intronic
1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG + Intergenic
1090342123 11:126033232-126033254 GCTGCTGTTTGAGGTGGTAGAGG + Intronic
1091728555 12:2863136-2863158 GCGCCTGTGGTGGGTGCTACTGG + Intronic
1091774307 12:3174497-3174519 TCTGCTGTGTTTGGGGCCAGGGG + Intronic
1092064235 12:5576612-5576634 GATGCTGTGTTGGGTGTGTGTGG - Intronic
1092132935 12:6125029-6125051 GCTGCTGTGTTTGGAGGAAGGGG + Intergenic
1092543425 12:9434051-9434073 GGTGCTGTGCTGGGGGCTATGGG - Intergenic
1095501116 12:42839661-42839683 GCAGCTGTTGTGGGGGCTAGGGG + Intergenic
1097041967 12:56161194-56161216 GCTGCTGGGAGGGGAGCTAGGGG + Intronic
1097064793 12:56313126-56313148 GTTGGGGTGTTGGGGGCTAGGGG - Intronic
1097245675 12:57606370-57606392 GCTGCTGGGTTGGGGGCCATGGG + Intronic
1101413743 12:104490988-104491010 GGTGCTGTGCTGGGTGGCAGGGG + Intronic
1101728683 12:107408859-107408881 GATGCTGTGCTGGGTGCCAGGGG + Intronic
1101851013 12:108402286-108402308 AGTGCTGTCTTGGGTGCTGGAGG + Intergenic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1104384553 12:128339121-128339143 GCGTCTGTGTTGGGGGCTGGGGG + Intronic
1105206505 13:18230314-18230336 GGTGCTGAGTTGGGTGCTTGAGG + Intergenic
1106850020 13:33780334-33780356 GCTGCTGTGTTTAGTGTTTGTGG + Intergenic
1107331398 13:39304905-39304927 GCAGATGTGTTGGGAGGTAGGGG + Intergenic
1108074508 13:46665879-46665901 GCTGCTGCTGTGGTTGCTAGTGG + Intronic
1110710259 13:78643340-78643362 TCTGCTGTGTTGCATGCTACGGG - Intronic
1113445389 13:110362378-110362400 GCTGCAGTGAAAGGTGCTAGGGG - Intronic
1114210766 14:20612530-20612552 GCTGCTGTGTGTGTTGTTAGGGG + Intergenic
1114766420 14:25376200-25376222 GCAGCTGTCTTTGGTGCAAGTGG + Intergenic
1116432958 14:44867351-44867373 TCTGCTGTCTTGGGTATTAGAGG - Intergenic
1117627578 14:57655597-57655619 GCTGCAGTGCTGGGTGGTACAGG - Intronic
1118507114 14:66425616-66425638 GTTGCTGGGTGAGGTGCTAGAGG - Intergenic
1118875721 14:69783369-69783391 GCTGGAGTGTTGGGTGTTATGGG + Intronic
1118890948 14:69908487-69908509 GCTGCTGTGCTGGAGGGTAGTGG + Intronic
1120815179 14:88849171-88849193 GGTACTTTGATGGGTGCTAGGGG + Intronic
1121237256 14:92401238-92401260 GCTGCTGTGCTGGTAGATAGGGG + Intronic
1122071814 14:99209858-99209880 GCTGCCCTGTTGAGGGCTAGTGG - Intronic
1122111049 14:99502891-99502913 GCTGCTGGGCTGGTTGCTGGGGG - Exonic
1125747073 15:42004499-42004521 GCTGCAGAGTTGGCTGCTTGCGG + Intronic
1128523582 15:68391508-68391530 GATGCTGTGTTGGCTGCTCTTGG + Intronic
1131361888 15:91800229-91800251 GTTGGTGGGTTGGGGGCTAGGGG - Intergenic
1132495229 16:259995-260017 GCTGCTGTGTCGGGGGCCAACGG + Exonic
1135525965 16:23213753-23213775 GGTGCTGTGTGAGGTGCTGGGGG + Intronic
1136485731 16:30570889-30570911 TCAACTGTGTTGGGTACTAGAGG - Intronic
1137247161 16:46715093-46715115 GCTGCTGTGCTCTGTGCTTGAGG - Intronic
1139670249 16:68487971-68487993 GCTGCTATGTTGGTAGCTAGAGG - Intergenic
1141837682 16:86553450-86553472 GCTGCTGTGCATGGTGCTTGTGG + Intronic
1142466140 17:138449-138471 GGTGCTGTGTTGGGTGGTCTTGG - Intronic
1143396600 17:6604103-6604125 GTTGCTGGGTTGTATGCTAGTGG - Intronic
1143404709 17:6669609-6669631 GCTTCTGTGATGGGTAATAGTGG + Intergenic
1145019063 17:19415921-19415943 GCTGCTGTGGGGGGTGCTGTGGG + Exonic
1145191356 17:20843575-20843597 GCCGCGGTGTTGGGGGCTGGGGG + Intronic
1145754813 17:27382633-27382655 GATGCTCTGATGGGTGCCAGGGG + Intergenic
1147265504 17:39232019-39232041 GCAGCTGGATTGGGTGTTAGCGG + Intergenic
1147326882 17:39673862-39673884 GCTGATGTGTTGGGGGTTGGGGG + Intronic
1149308227 17:55369788-55369810 GGTGCTGTTCTGGGTGCTAGGGG - Intergenic
1152201885 17:78952199-78952221 CCAGCTGTGTGGGGTGCTGGGGG - Intergenic
1152633002 17:81419168-81419190 GCTGCTGTGGCAGGGGCTAGAGG - Intronic
1156397472 18:36711644-36711666 GCTGCTATGTTGGTTGTAAGAGG - Intronic
1156448272 18:37252799-37252821 GCTACTGTGTTAGGTACTTGGGG - Intronic
1156774100 18:40766182-40766204 GTTGCGGGGTTGGGGGCTAGGGG - Intergenic
1157535982 18:48457591-48457613 GCTGCTTTGTTGGATCTTAGAGG - Intergenic
1159585212 18:70277516-70277538 TTTGCTGTGTTGGGAGCTTGAGG - Intergenic
1160154236 18:76421312-76421334 GCTGCTGTCCTGGCTGCCAGAGG + Intronic
1160643536 19:164062-164084 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1161281540 19:3448420-3448442 GCTGCTGAGTTGGGGGCTGTGGG + Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1163484039 19:17576129-17576151 GCCCCTGTGTTGGGCACTAGGGG + Intronic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
1165933512 19:39375461-39375483 GCTGATGGGTTGGGTGTTGGAGG + Intronic
1166345575 19:42163234-42163256 GGTGCTGTGTTGGGAGAGAGAGG + Intronic
1167590733 19:50402995-50403017 CCTGCTGTGTTGGGAGTGAGGGG + Intronic
1168242932 19:55096261-55096283 CCTTCTGTGTTTGCTGCTAGAGG + Exonic
925165122 2:1711095-1711117 GCTGGTGGAGTGGGTGCTAGTGG - Intronic
925165200 2:1711428-1711450 GCTGGTGGAGTGGGTGCTAGTGG - Intronic
927254883 2:21032430-21032452 GCTGCTGTGCTGAGGGCTCGGGG + Exonic
928113074 2:28525983-28526005 GCTGCTGTGTTGGGAAGGAGAGG - Intronic
932013464 2:68000803-68000825 GCTGGTGTGTTGGGCGGTGGGGG - Intergenic
932082972 2:68732188-68732210 GCTGCTGTGTTGGGCCCTTGTGG + Intronic
934683310 2:96302024-96302046 TCTGTTGAGGTGGGTGCTAGAGG - Intronic
935226866 2:101060339-101060361 GCAGCAATGTTGGGTGCAAGTGG - Intronic
936076337 2:109404083-109404105 GGTGCTGTGCTGGGTCCTGGAGG + Intronic
937288397 2:120767322-120767344 GGTGCTGGGCTGGGTGCTGGTGG + Intronic
937357309 2:121206106-121206128 GCTGCTGTGTGGGGTGGTGCAGG - Intergenic
937585527 2:123543298-123543320 GTTGCGGTGTTGGGGGCAAGGGG + Intergenic
940069659 2:149671660-149671682 GTTGCAGGGTTGGGGGCTAGAGG - Intergenic
940167675 2:150793058-150793080 GCTGGTGTGTTGGGTTATGGGGG - Intergenic
941059288 2:160827392-160827414 GCTGCTGTGTCTGGTTCTATGGG - Intergenic
941527008 2:166618535-166618557 TCTGCTGTTCTGGGTTCTAGAGG - Intergenic
946987682 2:225291507-225291529 GCTGTGGGGTTGGGGGCTAGGGG - Intergenic
948087616 2:235264709-235264731 GCTGCTGTGTTGGGCGGCACAGG - Intergenic
948396380 2:237648218-237648240 GGTGCTGAGTTGGCTGCTAGGGG - Intronic
948901037 2:240957024-240957046 GCTGCTGTCCTGGGTGGCAGGGG + Intronic
1168953343 20:1817502-1817524 GCAGCTGTGATGGGTTCAAGAGG - Intergenic
1169404844 20:5314785-5314807 GCTGATGTGTTGGGGGCTGGAGG - Intergenic
1169795633 20:9459769-9459791 GCTGCTGGGTTTGCTGCTCGTGG - Exonic
1170963632 20:21047469-21047491 GCTGCTGTGCTTGGTGGAAGAGG + Intergenic
1171445387 20:25199106-25199128 GGTTTTGTGTTGGGTGCTGGAGG + Intronic
1171448338 20:25220043-25220065 GCTGCTCTGCTGGGTGTGAGAGG - Intronic
1172062087 20:32193530-32193552 GCTACTGTGTAGGGTGGGAGGGG + Exonic
1174191468 20:48743521-48743543 GCAGGTGGGCTGGGTGCTAGCGG - Intronic
1174447895 20:50602617-50602639 CCTGCTGTGTTGGCTGCTGTAGG + Exonic
1174988803 20:55486626-55486648 GGTGCTGTGTTGGGCACTGGAGG - Intergenic
1175781442 20:61684736-61684758 GCTGCTGTGCTGGGTGGGTGTGG - Intronic
1176022181 20:62967494-62967516 GCTGTGGGGTTGGGAGCTAGAGG - Exonic
1179193579 21:39144021-39144043 GCTGCTGTTCTAGGTGCTTGAGG - Intergenic
1180087188 21:45513043-45513065 GCTGCTGTGCTTGGTGTTGGAGG - Exonic
1180582955 22:16858838-16858860 GATGCTGTGTTAAGTGCTTGGGG + Intergenic
1180759448 22:18188394-18188416 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1180769758 22:18372694-18372716 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1180776571 22:18489972-18489994 GGTGCTGAGTTGGGTGCTTGAGG + Intergenic
1180809299 22:18747341-18747363 GGTGCTGAGTTGGGTGCTTGAGG + Intergenic
1180827695 22:18875650-18875672 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1180943918 22:19679308-19679330 GCAGCTTTGTTGGGTTCTGGTGG - Intergenic
1181072220 22:20352322-20352344 GGTGCTGAGTTGGGTGCTTGAGG + Intronic
1181120902 22:20668380-20668402 GCCGCGGTGTTGGGGGCTGGGGG - Intergenic
1181139099 22:20790986-20791008 GCTGCTGGGGTGGGTGGTACAGG - Intronic
1181195294 22:21181263-21181285 GGTGCTGAGTTGGGTGCTTGAGG + Intergenic
1181214153 22:21311511-21311533 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1181524601 22:23473149-23473171 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1182472187 22:30555411-30555433 CCTGCTGTGCTGGGAGCTGGAGG - Exonic
1182952097 22:34386506-34386528 GTTGCGGGGTGGGGTGCTAGGGG - Intergenic
1183284909 22:36955718-36955740 CTTGCTGTGTTGGGCGATAGGGG + Intergenic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1184349162 22:43932263-43932285 GCTGCTGTGTTGTGGGTTAGAGG + Intronic
1184539179 22:45108512-45108534 GCTACTGCTTTGGGTGCCAGAGG - Intergenic
1184886851 22:47351864-47351886 GAGGCTGTGGTGGGTGCCAGAGG - Intergenic
1203231587 22_KI270731v1_random:113878-113900 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
1203277795 22_KI270734v1_random:101647-101669 GGTGCTGAGTTGGGTGCTTGAGG - Intergenic
950473124 3:13198762-13198784 CTTGCTGTGTTGGGTGCTTTGGG - Intergenic
952651882 3:35737269-35737291 GCTGCTGTGGTGGCTGCTGTTGG - Exonic
952946761 3:38483010-38483032 GCTGCTGTGGTTGGGGCTGGTGG + Intronic
953307641 3:41844504-41844526 GGGGCTGTGTGGGGTGCTTGCGG - Intronic
953754392 3:45634006-45634028 GCTACCTTGCTGGGTGCTAGGGG + Intronic
954576293 3:51678167-51678189 GCTTCTGCGGTGGGTGCTGGGGG + Intronic
954672350 3:52297833-52297855 GCGGCTCTGCTGGCTGCTAGTGG - Intergenic
954856708 3:53650050-53650072 GCTGCTGGGATGGATACTAGAGG + Intronic
955009805 3:55003020-55003042 GGTGCTGTACTAGGTGCTAGAGG + Intronic
955128249 3:56136595-56136617 CCTGCTGTGTGGTGTGTTAGTGG - Intronic
956491284 3:69774718-69774740 GTTGGGGTGTGGGGTGCTAGAGG + Intronic
957504590 3:81103274-81103296 GCTGCTGATTTGAGTGCTAACGG - Intergenic
961591672 3:127985975-127985997 GCTGCTGTGTTGGCTGTCGGCGG + Exonic
964701178 3:159569312-159569334 GTTGGTGTGTGGGGGGCTAGGGG - Intronic
964745281 3:160006583-160006605 GCTTAGGTGTTGGGTCCTAGCGG - Intergenic
965460039 3:168951339-168951361 GGTGCTGTGCTTGGTGCTATGGG - Intergenic
966453158 3:180085397-180085419 GCTGCTCTGAAGGGTGCCAGTGG + Intergenic
966863332 3:184242526-184242548 CTTGCTGTGTTGGGTGCTCTTGG + Exonic
968628266 4:1637669-1637691 GCAGCAGTGCTGGGGGCTAGGGG + Intronic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
973784424 4:54321695-54321717 AGTGCTGTGTTGGGTACAAGGGG - Intergenic
973817436 4:54631867-54631889 GCTGCTGTAGTGGATGCTATGGG - Intergenic
974950461 4:68579146-68579168 GTTGATGTGTTGGGTACTATGGG - Intronic
974958845 4:68674665-68674687 GTTGATGTGTTGGGTACTATGGG - Intergenic
976367546 4:84247132-84247154 GCTACTGTGTAGGGTGGGAGGGG - Intergenic
978651974 4:111016565-111016587 GCTGCTGTGTTTTGTACCAGTGG + Intergenic
980181444 4:129406386-129406408 GCTGCTGTGTTGTGAGGTGGTGG + Intergenic
980239120 4:130150245-130150267 GTTGGTGGGTTGGGGGCTAGGGG - Intergenic
980461785 4:133124968-133124990 GCTGCTCTGTTGGCTGCTTAGGG - Intergenic
981081809 4:140644330-140644352 GCTGGTGGGGTGGGAGCTAGGGG + Intronic
983295321 4:165859653-165859675 GCTGCTGTGTTGGGCAGCAGAGG + Intergenic
983888292 4:173005082-173005104 CCTCCTGTGTTGGGAGCTGGGGG + Intronic
984161446 4:176257147-176257169 GGTGCTTTGTTGTGTGCTGGAGG + Intronic
985491537 5:182542-182564 GCTGTTGTCTTGGGTGGAAGTGG - Exonic
986172584 5:5326350-5326372 GCTGCTGAGCTGGGAGCTAGAGG - Intergenic
989585719 5:43072707-43072729 GTTGATGTGTTGGGTACTATGGG + Intronic
989962941 5:50437733-50437755 GCTGCTGTGTTTGGGGTGAGAGG + Intronic
989963629 5:50443849-50443871 GCTGCTGTGTTTGGGGTGAGAGG - Intergenic
990580290 5:57161356-57161378 GCTTCTGCTTTGGGTGATAGAGG + Intergenic
992120362 5:73586170-73586192 GGTGCTGTGGCGGGTGATAGAGG + Intergenic
993795953 5:92268076-92268098 GCAGCTGTGTTGGGAGAGAGTGG - Intergenic
994614647 5:102089259-102089281 GCTCCGGTGTTGGGTCCTTGTGG + Intergenic
996765925 5:127033829-127033851 GCTGCTGTGGTGGGTGCTCCTGG + Intergenic
997281184 5:132646975-132646997 GCTGCTGTGTTGAGAACTACAGG - Intergenic
998003090 5:138639959-138639981 GATGCTCTCTTGGCTGCTAGGGG + Intronic
1000655931 5:163877745-163877767 GATACTGTTTTGGGTGCTAAAGG - Intergenic
1002751154 6:113389-113411 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1002959867 6:1904772-1904794 GCTGCTGTGCTGGGGGCTCCTGG - Intronic
1003300285 6:4874483-4874505 GCTGCAGTGTTAGGTGCTGTTGG + Intronic
1005858742 6:29885301-29885323 GCTGCTGTGAAGGGAGTTAGTGG + Intergenic
1018995318 6:168705713-168705735 CCTGGTGTGTTGTGTGCTGGAGG - Intergenic
1019338690 7:497162-497184 GGTGCTGTGTTGGGTGGAAACGG - Intergenic
1019341336 7:510429-510451 GCTGCAGTGTTGGATGCGTGAGG + Intronic
1019612028 7:1941500-1941522 GCTGCACTGTTGGGGGCCAGAGG - Intronic
1022405219 7:30083126-30083148 GCTGATGTGTTTGGTCTTAGAGG + Exonic
1023014836 7:35956466-35956488 GGTACTGTGCTTGGTGCTAGGGG + Intergenic
1024066168 7:45738554-45738576 GGTACTGTGCTTGGTGCTAGGGG - Intergenic
1024172559 7:46805228-46805250 GGTGCTGTGTTGGGGGAAAGGGG + Intergenic
1025217313 7:57069709-57069731 GGTGCTGTGCTTGGTGATAGGGG - Intergenic
1025654035 7:63500754-63500776 GGTGCTGTGCTTGGTGATAGGGG + Intergenic
1026846989 7:73704001-73704023 GCTGCTGAGTTTGGGGCTGGAGG - Intronic
1027045935 7:74991457-74991479 GCACCTGTCTTGGGTGCCAGGGG - Intronic
1028477153 7:91265048-91265070 GCTGCTGCTTTGGCTGCTGGAGG + Exonic
1029386886 7:100249114-100249136 GCACCTGTCTTGGGTGCCAGAGG + Intronic
1030481490 7:110110445-110110467 GCTACAGTGTTGGGTGGTGGGGG + Intergenic
1033145316 7:138866050-138866072 TGTGCTGTGTTGGGTTCTGGGGG - Intronic
1033356403 7:140603604-140603626 GGTATTGTTTTGGGTGCTAGGGG - Intronic
1034441486 7:151087886-151087908 CCTGGTGTGGTGGGTGCTGGAGG + Intronic
1034867234 7:154652123-154652145 GCTGATGTGTTGGGAGCCTGCGG - Intronic
1036020256 8:4836907-4836929 GCTGCTGTGTAGAGTTCTAATGG + Intronic
1037838880 8:22230357-22230379 GCAGCTGTGTTTGGCGGTAGGGG + Intronic
1038914817 8:32009404-32009426 GATGCTGTTTTAGGTGCTAGGGG + Intronic
1039028628 8:33285695-33285717 GCTGATGTGTGGGGTGATAGAGG + Intergenic
1042499465 8:69492535-69492557 GCTACTGTGTCGGGTGCTCAGGG + Intronic
1044462183 8:92458419-92458441 GCTGATGTGTTGAGTGATGGAGG - Intergenic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046688678 8:117257186-117257208 GTTGCGGTGTGGGGGGCTAGGGG + Intergenic
1048205619 8:132412938-132412960 GCTGATGTGTTGGGAGGTGGTGG - Intronic
1048271522 8:133032065-133032087 TGTGCTGTGTGGGGTGCTCGGGG - Intronic
1048445905 8:134493209-134493231 GCAGCTGTGTTGGCCGGTAGTGG - Intronic
1049280762 8:141742973-141742995 GCTTCTGTGTGGAGTGCTGGAGG + Intergenic
1049309048 8:141923713-141923735 GCTGCCATGTGGGGTGCTGGCGG - Intergenic
1049617620 8:143582541-143582563 CCTGCTGTGTGGGGTGCATGAGG - Intronic
1049853198 8:144845345-144845367 CCTGCTCTGTTGGGAGCTGGGGG + Intronic
1052180376 9:25519004-25519026 GCTCCTGTCCTGGGAGCTAGGGG - Intergenic
1053283101 9:36834233-36834255 TCTGTTGTGCTGGGTGCTTGGGG + Exonic
1053364147 9:37511120-37511142 GCTGCTCTGTTGGGTGGGATGGG - Exonic
1053509351 9:38674105-38674127 GCTGCTGTATTTGGTGCTGCTGG + Intergenic
1056617274 9:88179224-88179246 GTGGCTGTGGTGGGTGCTGGGGG + Intergenic
1060816192 9:126636554-126636576 GCTGCTGTGTGGATTGCAAGGGG + Intronic
1062757791 9:138313041-138313063 GCTTCTGTGTTGGCTCCTTGAGG + Intergenic
1186964383 X:14772124-14772146 TGTGCTGTGTTGGGGGCTGGAGG + Intergenic
1187257023 X:17652989-17653011 GGTACTGTGCTGGGTGCTTGTGG - Intronic
1190056907 X:47186414-47186436 GATGCTGTGAGGGGTGCTGGGGG - Intronic
1191047144 X:56150599-56150621 CCTGCTGTGTTGGATGCTCTTGG + Intergenic
1191151053 X:57221246-57221268 GTTGATGTGTTGGGTACTATGGG - Intergenic
1191192012 X:57677659-57677681 GCTGCTGTTTTGGTTGTCAGCGG - Intergenic
1191610080 X:63102611-63102633 TCAGCTGTGCAGGGTGCTAGTGG - Intergenic
1191631656 X:63328709-63328731 TCTGCTGTGTTCAGTTCTAGGGG - Intergenic
1191857624 X:65639956-65639978 GGTGCTGTGCTAGATGCTAGGGG + Intronic
1192547588 X:72026821-72026843 TCTGCTGGGTTGGGTGATGGTGG - Intergenic
1192584026 X:72306324-72306346 GCTGCTCTGCTGGGGGCGAGGGG - Intronic
1194010639 X:88556821-88556843 GTTGCGGTGTGGGGGGCTAGGGG - Intergenic
1195651728 X:107291785-107291807 GCTGCGGGGTCGGGGGCTAGGGG + Intergenic
1196214857 X:113038641-113038663 GCTGCTGGGGTGGGCGGTAGGGG - Intergenic
1197621338 X:128753085-128753107 GTTCCTGTGTTGTTTGCTAGGGG + Intergenic
1198096491 X:133384806-133384828 TCTGTTGTGTTGGGAGCCAGTGG - Intronic
1198523110 X:137472686-137472708 GCTCCAGTGTTGGGTTCTTGAGG - Intergenic
1201517893 Y:14837432-14837454 ATGGCTGTGTTAGGTGCTAGGGG + Intronic