ID: 969856071

View in Genome Browser
Species Human (GRCh38)
Location 4:10000850-10000872
Sequence TTGGCTGAGCAACTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969856071 Original CRISPR TTGGCTGAGCAACTGGAGAA TGG (reversed) Intronic
900703872 1:4063842-4063864 TTAGCTGAGAAAATGAAGAAAGG + Intergenic
901530258 1:9848582-9848604 CTGGCTGAGCCCCTGGGGAAAGG - Exonic
902093589 1:13923992-13924014 TTGGCTGAGAGAATAGAGAATGG + Intergenic
903356988 1:22754478-22754500 TTGGCTGGGCTTCTGCAGAAGGG + Intronic
903476462 1:23622534-23622556 TGTGCTCATCAACTGGAGAATGG - Intronic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
905446494 1:38031181-38031203 CCTGCTGAGCATCTGGAGAATGG + Intergenic
905731567 1:40302504-40302526 GTGGCTGAGGAACCGGGGAAGGG + Intronic
906113445 1:43339500-43339522 TGGGCTGAGCACATGGAGACTGG - Exonic
906187758 1:43873975-43873997 TTGAGGGAGCAACTGCAGAAAGG + Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
906874209 1:49518353-49518375 TTGGTTGAGTGAATGGAGAAGGG - Intronic
907256648 1:53184289-53184311 TTGTCTGAGTAACTGAAAAATGG + Intergenic
908104436 1:60826909-60826931 TTGGCTGAGGGAATGAAGAATGG - Intergenic
908725224 1:67168664-67168686 TTGGTTGAGTAGCTAGAGAATGG + Intronic
909547370 1:76862823-76862845 TGGACTGGGCAGCTGGAGAATGG - Intergenic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
910544623 1:88399857-88399879 GTGGCTGTGGAACTGGATAATGG - Intergenic
911179539 1:94848547-94848569 TTGGCTGTGAATCTGGATAAGGG + Intronic
913273191 1:117114070-117114092 ATGGCTGAGAAATTGGAGAAGGG - Intronic
913309412 1:117473264-117473286 TTTGCTGAGAAACTGGAGTGGGG - Intronic
914885899 1:151584235-151584257 TTGGCTGAGAAGCAGGAGAAGGG - Intergenic
917544194 1:175945839-175945861 TTAGCTGAGCAGCAGGGGAAAGG - Intronic
919550975 1:198987188-198987210 TTGCCTGAGCAACTGGTAGATGG + Intergenic
920588604 1:207194596-207194618 CAGGCTGAGGAACTGTAGAAAGG - Intergenic
922002349 1:221492323-221492345 TAGTCTGAGGAACAGGAGAAAGG + Intergenic
1063882545 10:10545965-10545987 TTGGCTGTGTTCCTGGAGAAAGG + Intergenic
1064884000 10:20089352-20089374 TAGGCTGAGAAGCTGGGGAAGGG + Intronic
1066811823 10:39348570-39348592 TTGATTGAGCAGTTGGAGAACGG - Intergenic
1070468293 10:76748380-76748402 TTTGGTGAGCATGTGGAGAAAGG + Intergenic
1070662874 10:78320098-78320120 TTGGCTGAGCACATGGAAGAGGG + Intergenic
1071983138 10:91023778-91023800 TTGGCTGAAAGACTGGATAATGG - Intergenic
1072098668 10:92207989-92208011 TTGGCTTAACAAGAGGAGAAAGG + Intronic
1073448357 10:103594365-103594387 TCAGCAGAGAAACTGGAGAAAGG - Exonic
1073698667 10:105899447-105899469 TTGGCTTTGAAATTGGAGAAAGG + Intergenic
1074318980 10:112383375-112383397 TGGCTTGAGCAACTGGTGAATGG + Intronic
1074642135 10:115398135-115398157 TTACCTGAGCAACTGGTGGAAGG - Intronic
1075523114 10:123156436-123156458 TGAGTTGAGCAACAGGAGAATGG + Intronic
1075827182 10:125369095-125369117 TTAGCTTAGCAACTGTAGTATGG + Intergenic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1076673843 10:132137577-132137599 TGGGGTGAGCAGCCGGAGAAGGG - Intronic
1078134559 11:8641039-8641061 CTTGCTGAGCCACTGGAGACTGG + Exonic
1078548955 11:12267369-12267391 TGGGCTGAGCAACAAGAAAAGGG - Intergenic
1078656934 11:13250069-13250091 TTGCCTCATCAACTAGAGAAGGG + Intergenic
1079324790 11:19482441-19482463 TTGCCTGTGGAACTGGAAAAAGG + Intronic
1083168024 11:60903524-60903546 TTGGGTGAGCAACTGCCGAAAGG + Exonic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1084613234 11:70217567-70217589 TTGGCTTAGCAGCTGAAGACTGG - Intergenic
1088437819 11:109834724-109834746 TTGGCTGAGAAACATGACAAAGG - Intergenic
1088909317 11:114178947-114178969 TGGGCTGAGCAACAGAACAACGG - Intronic
1088972231 11:114783812-114783834 TTGGTTGAGCAACTCTTGAATGG - Intergenic
1088999365 11:115038202-115038224 TTGCCTGGGCAACTGGAAAGAGG - Intergenic
1089894591 11:121917280-121917302 CTGGCACAGCAACTGGAGCAAGG - Intergenic
1090658119 11:128861265-128861287 CTGACTGAGCAACTGAAGCAGGG + Intronic
1090716141 11:129433187-129433209 TGGTCTTAGCAACTGGAGGAAGG - Intronic
1091170208 11:133513417-133513439 TTGGCTGGGAAACAGGAGACAGG - Intronic
1091292624 11:134450348-134450370 TGGACTCAGCACCTGGAGAAGGG + Intergenic
1092181075 12:6447361-6447383 TTGGCTGAGCTCCCAGAGAAGGG - Intronic
1093067692 12:14675664-14675686 GTGCCTCAGCAGCTGGAGAATGG + Intronic
1094107543 12:26830476-26830498 TTGGCTGGGAATCTGGAGACAGG + Intronic
1094484329 12:30912254-30912276 TTCGAAGAGCAACAGGAGAAGGG + Intergenic
1096913280 12:55005416-55005438 TGGCCTGAGCAACGGGGGAAAGG + Intergenic
1101116563 12:101537669-101537691 TTGGTTGGATAACTGGAGAAGGG - Intergenic
1103159798 12:118719595-118719617 CTGGCTGAGAAACTGGAGCAGGG - Intergenic
1104751467 12:131242747-131242769 TGGGCTGAGCAACAGGGGAGGGG + Intergenic
1104762051 12:131302928-131302950 TTGGCTAAGGGATTGGAGAATGG - Intergenic
1104803202 12:131568732-131568754 GTGGCTCAGTAACTGAAGAATGG - Intergenic
1104817725 12:131657856-131657878 TTGGCTAAGGGATTGGAGAATGG + Intergenic
1105917274 13:24928212-24928234 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1106935718 13:34716821-34716843 TAGGCAGAGCAACTGGACAAGGG - Intergenic
1106937160 13:34735651-34735673 TGGCCTGAACAACTGGAGAATGG - Intergenic
1107239839 13:38219155-38219177 TTGGCTTAGAAGATGGAGAAAGG - Intergenic
1107609980 13:42103446-42103468 TTGGCGAAGCACCTGGAGACAGG + Intronic
1108847712 13:54696559-54696581 TTGTCTGAGCCACTGGAGCCAGG + Intergenic
1110905430 13:80881784-80881806 TTGGCTAAGGAACTGGAGTCAGG - Intergenic
1111673920 13:91363511-91363533 TTGGGTGAAAACCTGGAGAATGG + Intergenic
1113050202 13:106202779-106202801 TTGTCTGTCCAACTGGAGCAGGG - Intergenic
1113472261 13:110555440-110555462 ATGGCTGAGCCACCTGAGAAGGG - Intronic
1114290490 14:21284254-21284276 TTGACTTGTCAACTGGAGAAGGG - Intergenic
1114709935 14:24767992-24768014 TCGGCTGAGCAACAAGGGAAGGG + Intergenic
1114738684 14:25070538-25070560 TTGACTGAATAACTGGAAAAAGG + Intergenic
1115529922 14:34317584-34317606 TTGGCTGAGGAACTGAAGGCAGG + Intronic
1115865652 14:37743792-37743814 TAGGCAGAGAAACTGCAGAAAGG - Intronic
1116578419 14:46606042-46606064 TTGGCTGCGCTACTGGACAATGG - Intergenic
1117525379 14:56597025-56597047 TTGGATGAGAACCTAGAGAAGGG + Intronic
1117913566 14:60655831-60655853 TGGGATGAGGAACAGGAGAAAGG - Intronic
1118438558 14:65792694-65792716 TTGGCTGACCAGAGGGAGAAGGG + Intergenic
1118667309 14:68085006-68085028 TTTGGTGATTAACTGGAGAAAGG + Intronic
1118824884 14:69371132-69371154 TTGCCTGAGCAGCTGGTGACTGG + Intergenic
1119049607 14:71353811-71353833 TTGCCTGAGCAACTGGAAAGAGG + Intronic
1119174309 14:72557910-72557932 TGGGCCCAGCAACTGAAGAAGGG + Intronic
1119788589 14:77330096-77330118 TTGTCAGGGCAACTGGAGCATGG + Intronic
1119997381 14:79268451-79268473 GTGGCTGAGCAACAAGAAAAAGG - Intronic
1120877792 14:89390982-89391004 TAACCTTAGCAACTGGAGAAAGG - Intronic
1122504508 14:102223040-102223062 TTGGGTGAGCAGCGGGAGCACGG - Intronic
1126541881 15:49832848-49832870 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1126771124 15:52057023-52057045 TTGTCTAAGCAACTGAAAAATGG - Intronic
1127588752 15:60401556-60401578 GAGGCTGAGCAGCAGGAGAATGG + Intronic
1128763380 15:70235120-70235142 TTGGCTTATCATCTGGAAAATGG + Intergenic
1128952621 15:71902595-71902617 TAGACTGAGAAACTGGAAAAAGG + Intronic
1131465782 15:92654093-92654115 TGGTCTGAGAAAATGGAGAAAGG - Intronic
1132112257 15:99110171-99110193 TGGCCTGAGCAACTGGAAGAAGG + Intronic
1132179275 15:99739849-99739871 TTGGCTGTGCACGTGGGGAAAGG + Intergenic
1133814873 16:9189254-9189276 TTGGCTGAGCAGCAGGGAAAGGG + Intergenic
1135988663 16:27203639-27203661 TAGTCTGAGCAACTCGAGAGCGG + Intronic
1136131381 16:28223975-28223997 TTTGCTGAGCACCTAGAGTATGG - Intergenic
1137268794 16:46889027-46889049 TTTGCAGAGCACCTGGCGAAAGG + Intronic
1137722999 16:50638847-50638869 TTGGCTGGTCAGCTGGAGACAGG - Exonic
1139689297 16:68629688-68629710 TTGCCTGAGGAGCTGGAGGAAGG - Intergenic
1140674648 16:77315992-77316014 TTCCCTGAGCATCTGGAGGATGG - Intronic
1141053687 16:80796358-80796380 TTGACTGAGTAACTGGAGACTGG + Intronic
1141212725 16:81996213-81996235 TTGGCTAGGCATGTGGAGAATGG + Exonic
1143237993 17:5419668-5419690 CGGGCTGAGCAACTGGAGTGAGG - Exonic
1143316792 17:6038976-6038998 TGGTCTGAGCATCTGGAAAATGG + Intronic
1144381283 17:14701098-14701120 TGCGATGAGCAAATGGAGAATGG - Intergenic
1145303500 17:21656698-21656720 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1145346544 17:22045151-22045173 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1147185299 17:38710175-38710197 ATGGGTGAGCAGCGGGAGAATGG + Intronic
1147356895 17:39905451-39905473 GTGGCTGAGGCCCTGGAGAAGGG - Exonic
1148165865 17:45483574-45483596 CTGGCTGAGCATCAGGGGAAAGG + Intronic
1148745204 17:49914208-49914230 AGGGCTGAGCAGCTGGAGGAGGG - Intergenic
1149428691 17:56579246-56579268 TTGGCTGAGCGACAAAAGAATGG + Intergenic
1150128390 17:62653164-62653186 TTGCCGGAGGAACTGGAGAGCGG - Intronic
1150810507 17:68352987-68353009 TTGTCTGAGCCACTTGGGAAAGG + Intronic
1153852371 18:9107662-9107684 TTGTTTGAGCAACTTCAGAAAGG - Intronic
1155303753 18:24458147-24458169 AGGGCTGAGTAACTGGAAAAGGG + Intergenic
1156679761 18:39574008-39574030 GAGGCTGAGCAGCAGGAGAACGG + Intergenic
1158992672 18:62886004-62886026 ATGGCTGTGAAGCTGGAGAAAGG + Intronic
1159781017 18:72660280-72660302 ATGGCTGAGTAACTTGAGACAGG + Intergenic
1161219616 19:3112447-3112469 TTGGCTGAGGGACTGGGGAGGGG - Intronic
1161748360 19:6075602-6075624 TGGCCTGAGCACCTAGAGAATGG + Intronic
1163152691 19:15424498-15424520 ATGGGTAAGCAACTGGAGAAAGG + Intronic
1164292828 19:23882551-23882573 CTGGCTGAGCAACGGATGAAAGG + Intergenic
1164398856 19:27889162-27889184 GTGGTTGAGTGACTGGAGAAGGG - Intergenic
1167789289 19:51662871-51662893 TGGTCTGAGCAGCTGGAAAATGG - Intergenic
925021260 2:570156-570178 GTGGCTGAGTAACTGGAAAGAGG - Intergenic
925693956 2:6554338-6554360 TTGGCTGGGGAAGTTGAGAAAGG + Intergenic
925712658 2:6757238-6757260 TTGGATGAGCAACTCTAGGAAGG - Intergenic
927675865 2:25105644-25105666 TTGCCAGAGCAACTTGACAAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
931479619 2:62627915-62627937 TTGGCCGAGCAACAGATGAAAGG - Intergenic
931784711 2:65608645-65608667 TTGGCTGAGTGAGGGGAGAAGGG + Intergenic
932475208 2:72001431-72001453 GTGCCTGAGCAACTGGTGGAGGG + Intergenic
934714031 2:96532973-96532995 TTGGCTGAGTAGCTGGAGCGGGG + Intergenic
936075667 2:109400138-109400160 ATTGCTGAGCTTCTGGAGAAGGG + Intronic
936835380 2:116703433-116703455 TTGACTGAGCAATGGAAGAAGGG + Intergenic
940840916 2:158580841-158580863 TTTCCTGAGAAACTTGAGAAAGG - Intronic
941675730 2:168341686-168341708 TTTGGTGAGGAACAGGAGAAAGG - Intergenic
942941169 2:181619447-181619469 ATTGCTGAGAAGCTGGAGAAAGG - Intronic
943108950 2:183582186-183582208 TTGACTTTGAAACTGGAGAAAGG - Intergenic
944098751 2:195998469-195998491 AAGGCTGAGCAGCAGGAGAATGG + Intronic
946096171 2:217275786-217275808 AGGCCTGAGCATCTGGAGAAGGG - Intergenic
946434270 2:219641576-219641598 TTGGAGGAGGAGCTGGAGAATGG + Intronic
948301706 2:236912434-236912456 GCGGCTGAGCCACTGCAGAAGGG - Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1171143270 20:22760982-22761004 TTGGCTAAGCATCTGGGGAGGGG - Intergenic
1171521020 20:25774381-25774403 TGGGCTGAGCAGGTGGAGTAGGG - Exonic
1171555905 20:26082095-26082117 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1172873211 20:38148435-38148457 TTGGCTGAGCAAGAGGAGAAAGG - Intronic
1173002233 20:39112496-39112518 GTGGCTGAGCAGCTGTAGGAAGG + Intergenic
1173568932 20:44064569-44064591 TTGGCTGAGGAACTGGGATATGG + Intronic
1174049336 20:47756978-47757000 ACGGTTGTGCAACTGGAGAAGGG + Intronic
1174872826 20:54199450-54199472 CTGGCTGAACAATAGGAGAAAGG + Intergenic
1175552113 20:59824203-59824225 TTGGTTGAGTAACTGGGGACTGG + Intronic
1175901760 20:62362680-62362702 TTTGCTGAGCAAGTGGATGAGGG - Intronic
1176188052 20:63792290-63792312 TTGACTTATCAGCTGGAGAATGG - Intronic
1179231933 21:39511875-39511897 TTTGCTTAGTAACAGGAGAAAGG + Intronic
1179468346 21:41593338-41593360 GTTGCCTAGCAACTGGAGAAGGG + Intergenic
1181604005 22:23969108-23969130 TTGTCTGAGCAAAGGGAGAGTGG - Intronic
1181604508 22:23972198-23972220 TTGTCTGAGCAAAGGGAGAGTGG + Exonic
1182018968 22:27064949-27064971 CTGGCAGAGCAATTAGAGAACGG - Intergenic
1182103849 22:27675126-27675148 TGGGGTGAACAACTGGAGAACGG - Intergenic
1182958275 22:34447762-34447784 TTGACTGAGCAACTGGGAGAAGG - Intergenic
1183828054 22:40403963-40403985 TAGGCTGAGCATCGGGAGAATGG + Intronic
1183961621 22:41414678-41414700 GTGGCTCAGCAGCTGCAGAATGG + Intergenic
1184297986 22:43538176-43538198 CAGGCTGAGCAACTGGAAGAAGG - Intronic
951363253 3:21749972-21749994 TTGATAGAGCAACTGGAGAGGGG - Intronic
951453417 3:22864606-22864628 TAGGTTGAGCAACTGGAAGAAGG + Intergenic
951836104 3:26985109-26985131 TTGGCTGAACAAATTCAGAATGG + Intergenic
953148266 3:40299831-40299853 GTGGCTTAGGAACTGGATAATGG - Intergenic
955135024 3:56208867-56208889 CAGGCTGAGAAACTGCAGAATGG + Intronic
955582625 3:60440818-60440840 CAAGCTGAGCAACTGGAGAGAGG - Intronic
957238618 3:77627781-77627803 TTGGTTGAAAAAATGGAGAATGG + Intronic
960222818 3:115135130-115135152 TTGGGCAAGCAACTGGAGAATGG - Intronic
960957068 3:123040110-123040132 TTTTCTGAGCTCCTGGAGAAAGG - Intergenic
962404561 3:135089768-135089790 ACTGCTGAGCAACTTGAGAAAGG - Intronic
962424874 3:135261048-135261070 ATGGCTGAACCCCTGGAGAATGG + Intergenic
962732051 3:138292588-138292610 TAGCCTGAGCAACTGGACAGAGG + Intronic
962735632 3:138322937-138322959 TTGTCTGGGCAACTGGAACATGG - Intronic
965562778 3:170077820-170077842 CTGGCCAAGCAACTGAAGAAAGG - Intronic
969503914 4:7571619-7571641 TTCCCTGAGCAAGTGGAGGAGGG + Intronic
969856071 4:10000850-10000872 TTGGCTGAGCAACTGGAGAATGG - Intronic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971141887 4:23933530-23933552 GTGACAGAGGAACTGGAGAATGG + Intergenic
976924172 4:90476211-90476233 AAGGCGGAGCAGCTGGAGAAGGG - Intronic
978052147 4:104214732-104214754 TAAGCTGAGGAATTGGAGAAAGG + Intergenic
978957667 4:114634161-114634183 TTGCTTGAGCAACTGGTGGATGG + Intronic
979479491 4:121199899-121199921 TTGGCTGGGCAAGTAGAGAATGG - Intronic
981610289 4:146586802-146586824 TGGCCTGAGCAAGTGGAGAAAGG - Intergenic
981798732 4:148630833-148630855 TGGGCTGGGCAAGTGCAGAAGGG + Intergenic
982353738 4:154444447-154444469 TTGGCTGATGAACTGGATGAGGG - Intronic
982672804 4:158342580-158342602 TGGGCTGAGGGAATGGAGAAAGG - Intronic
984936102 4:184890453-184890475 GTGGGTAAGAAACTGGAGAATGG - Intergenic
986692150 5:10321950-10321972 TTGACAAAGCAACTGTAGAAAGG + Intergenic
990467311 5:56082471-56082493 TGGCTTGAGCAACAGGAGAAAGG - Intergenic
991544344 5:67765015-67765037 GTGGGTGAGCAAAAGGAGAAAGG + Intergenic
995072093 5:107935698-107935720 TTGGCTTAGTAATTGGAAAATGG - Intronic
997387673 5:133486425-133486447 TTCTCTGAGGAACAGGAGAAAGG + Intronic
1001219026 5:169883420-169883442 TTGGCTCAGCATCTTGAGGATGG - Exonic
1001313910 5:170629564-170629586 CTAACTGAGCACCTGGAGAAAGG - Intronic
1001638369 5:173228771-173228793 CAGGCTGAGCTCCTGGAGAAAGG - Intergenic
1001931302 5:175674983-175675005 TTGGCTTTGCAGGTGGAGAAAGG - Intronic
1004048484 6:12049356-12049378 GTGGGTCAGCACCTGGAGAAAGG + Intronic
1004453008 6:15764853-15764875 TGGGTTATGCAACTGGAGAATGG + Intergenic
1004873515 6:19931890-19931912 TGGCCTGAGCAACTGGAAAATGG + Intergenic
1005866287 6:29940088-29940110 TTGGTTGAATAACTGGAGGAAGG - Intergenic
1007122172 6:39391459-39391481 TGGGCTTAGCAGCTGGAGAGGGG - Intronic
1007435275 6:41806165-41806187 GTGGCTGAGCACCTGGAGGATGG + Exonic
1007499801 6:42288027-42288049 TAGGCTGAGAAGGTGGAGAATGG - Intronic
1010016081 6:71105904-71105926 TTGGATGAGCAAATGTAGAAAGG + Intergenic
1010282390 6:74036651-74036673 TGGCTTGAGCAAATGGAGAATGG - Intergenic
1010395974 6:75392506-75392528 TTGCCTGAGCAAATGGGAAATGG - Intronic
1012394428 6:98779794-98779816 TAGCCTGAGTAACTGGAGAGAGG + Intergenic
1014275439 6:119382575-119382597 CTGGCTGAGCAACGGATGAAAGG - Intergenic
1014810781 6:125883183-125883205 TTTACTGAGCCTCTGGAGAAGGG + Intronic
1015994012 6:138979457-138979479 ATGGCTGAGGAACTAGAGACAGG - Intronic
1017187060 6:151612242-151612264 GTGGCTGAGCATCTGAATAATGG - Intronic
1017731199 6:157317757-157317779 TGGCCTGAGCAACTGAAGGATGG - Intronic
1018167539 6:161112794-161112816 CTGGCGGAGCAACTTCAGAAGGG + Intronic
1020182647 7:5934335-5934357 TTGGCTGAGCATTGGCAGAATGG - Intronic
1020300264 7:6790422-6790444 TTGGCTGAGCATTGGCAGAATGG + Intronic
1022716095 7:32900067-32900089 TTAGCTGAGCAGGTAGAGAAAGG + Intergenic
1025281496 7:57629331-57629353 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1025303234 7:57836184-57836206 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1026369470 7:69684190-69684212 TTAAAGGAGCAACTGGAGAAAGG + Intronic
1026616792 7:71912281-71912303 TTTGCTGAGGAACTGAACAAGGG - Intronic
1026769277 7:73184059-73184081 TTGGGTGGGCAAGTGGAGGAAGG + Intergenic
1027010147 7:74737442-74737464 TTGGGTGGGCAAGTGGAGGAAGG + Intronic
1027077895 7:75208593-75208615 TTGGGTGGGCAAGTGGAGGAAGG - Intergenic
1027426976 7:78071199-78071221 TTGGCTGAGCATCAGGGAAAAGG + Intronic
1032550192 7:132777635-132777657 TTGCCTGAGCAACTACTGAATGG - Intergenic
1032932412 7:136689116-136689138 TTGGCTGGGCCAAAGGAGAAAGG - Intergenic
1033831554 7:145260227-145260249 ATAGCAGAGAAACTGGAGAAAGG - Intergenic
1037522608 8:19694721-19694743 ATAGCTGAGCAACTAAAGAAGGG - Intronic
1039532768 8:38278359-38278381 TTGTCTGGGCAACGGCAGAACGG - Exonic
1039801783 8:40964243-40964265 TTGGCTGACAAATAGGAGAATGG + Intergenic
1040039618 8:42902971-42902993 TTGACTTGGCAACTGTAGAATGG + Intronic
1040472115 8:47742466-47742488 TTGGGTGGCCATCTGGAGAATGG - Intergenic
1041762772 8:61384850-61384872 TTAGATGAGAAGCTGGAGAATGG + Intronic
1041959356 8:63594776-63594798 GGGCCTGAGCAACTGGAAAAAGG + Intergenic
1042670563 8:71258366-71258388 TTGCGTGTGCAACTTGAGAAGGG + Intronic
1045017939 8:98015089-98015111 TGGACTGAGCAACTGAAGGATGG - Intronic
1045167452 8:99622750-99622772 TGGCCTTAGCAACTGGAAAAGGG - Intronic
1047388148 8:124428501-124428523 CTGGCTGGGCACCTGGGGAACGG - Intergenic
1047708463 8:127525855-127525877 TTGACTGAGCTTCTGGAGTAGGG - Intergenic
1048524960 8:135194013-135194035 TTGGCTGAGCAACTAAAGAATGG - Intergenic
1049918630 9:343042-343064 ATGGGTGAGGAACTGGAAAATGG - Intronic
1050017429 9:1249097-1249119 TTGGCTGAGGATTTGGATAAAGG + Intergenic
1050065713 9:1757652-1757674 TTGGTTGAGCAACCAGAGGATGG + Intergenic
1052049170 9:23825426-23825448 TTGGCTCAGCAACGGAAGGACGG - Intronic
1052689153 9:31793483-31793505 TTGTCTGAGAAACTGGGGAATGG - Intergenic
1053650436 9:40163468-40163490 CTGGCTGAGCAACAGAAGAAAGG + Intergenic
1053755301 9:41300458-41300480 CTGGCTGAGCAACAGAAGAAAGG - Intergenic
1054330942 9:63755241-63755263 CTGGCTGAGCAACAGAAGAAAGG + Intergenic
1054534148 9:66212735-66212757 CTGGCTGAGCAACAGAAGAAAGG - Intergenic
1055122995 9:72684789-72684811 TTGCTTGAGCACCTGAAGAATGG - Intronic
1055196058 9:73595452-73595474 TAGGCTTAGCAAATGAAGAATGG - Intergenic
1055237709 9:74143894-74143916 ATGGCTAAGCAACTGGAAATGGG - Intergenic
1055245365 9:74234980-74235002 TTGGCTAAGGAACTTGAGATGGG - Intergenic
1055904869 9:81281507-81281529 TTGGCTGAGCTTCTAGAGACAGG - Intergenic
1056118993 9:83468778-83468800 TTTGCTCAGCTATTGGAGAAGGG + Intronic
1056726506 9:89123686-89123708 GTGGCTGAGAAACAGGAGGACGG - Intronic
1058180326 9:101790485-101790507 TGTGCGGAGAAACTGGAGAAGGG + Intergenic
1058186430 9:101860800-101860822 TTTGCTGTGTAACTGGGGAATGG - Intergenic
1059723634 9:116985493-116985515 CTGGCTGAGAACCTGGAGCAGGG - Intronic
1061516758 9:131094629-131094651 TCGGCTGAGAAACTGGAGGGAGG - Intergenic
1062000766 9:134214635-134214657 GTGGCTGAGCTACTGGAGATGGG + Intergenic
1062509092 9:136895015-136895037 TTGGCTGAGTCCCTGGTGAATGG + Intronic
1202798324 9_KI270719v1_random:148158-148180 CTGGCTGAGCAACAGAAGAAAGG + Intergenic
1186487861 X:9947271-9947293 TTGGCTCAGCATCTGAAGACGGG - Exonic
1187357508 X:18590944-18590966 TGTGCTGAGAATCTGGAGAATGG - Intronic
1188517348 X:31001771-31001793 TTGGCTGTGCAATTGAAGACTGG + Intergenic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1192307995 X:69983867-69983889 TTTGCTGAGGATGTGGAGAATGG - Intronic
1194377498 X:93153563-93153585 TTGGCTGAGATTATGGAGAAAGG + Intergenic
1194472755 X:94317721-94317743 ATGGCTGTGAAACTGGATAAGGG - Intergenic
1194964051 X:100267361-100267383 GTGACAGAGCACCTGGAGAAAGG + Intergenic
1195244562 X:102983770-102983792 GAGGCTGAGCACCTGGGGAAGGG - Intergenic
1195341111 X:103906924-103906946 TTGGCTGAGCCAGTGGAGACAGG + Intergenic
1195341599 X:103912010-103912032 TTGGCTGAGCCAGAGGAGACAGG - Intergenic
1195697136 X:107675484-107675506 TTGGCTGTCCATTTGGAGAAGGG + Intergenic
1196412281 X:115433056-115433078 TTGGCAGAGCATCAGAAGAAAGG - Intergenic
1198103497 X:133441315-133441337 TTTGCTGAGCAAATGGAGCAGGG + Intergenic
1198776203 X:140182020-140182042 TTTTCTGAGCAAATGGAGACTGG - Intergenic
1199310817 X:146317811-146317833 ATGACTGAGCACCTGGGGAAAGG + Intergenic
1199374828 X:147095697-147095719 TGGCCTGGGCAACTGGACAAAGG + Intergenic
1199943927 X:152650722-152650744 TTGGCTGTGCACCTGTACAAAGG - Intronic
1200745919 Y:6903895-6903917 TTGGCTGATCACCTTGAGAAAGG + Intergenic