ID: 969860861

View in Genome Browser
Species Human (GRCh38)
Location 4:10034357-10034379
Sequence CTGGCACACCTGCAGTTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969860851_969860861 14 Left 969860851 4:10034320-10034342 CCCTCCTGCGACCCCGCACTTGT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860855_969860861 3 Left 969860855 4:10034331-10034353 CCCCGCACTTGTCAGCCAGGAAT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860856_969860861 2 Left 969860856 4:10034332-10034354 CCCGCACTTGTCAGCCAGGAATG 0: 1
1: 0
2: 4
3: 15
4: 129
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860852_969860861 13 Left 969860852 4:10034321-10034343 CCTCCTGCGACCCCGCACTTGTC 0: 1
1: 0
2: 1
3: 3
4: 73
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860850_969860861 18 Left 969860850 4:10034316-10034338 CCAGCCCTCCTGCGACCCCGCAC 0: 1
1: 0
2: 3
3: 26
4: 341
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860857_969860861 1 Left 969860857 4:10034333-10034355 CCGCACTTGTCAGCCAGGAATGT 0: 1
1: 0
2: 2
3: 19
4: 153
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860853_969860861 10 Left 969860853 4:10034324-10034346 CCTGCGACCCCGCACTTGTCAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
969860849_969860861 22 Left 969860849 4:10034312-10034334 CCGTCCAGCCCTCCTGCGACCCC 0: 1
1: 0
2: 1
3: 37
4: 497
Right 969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969860861 Original CRISPR CTGGCACACCTGCAGTTTCG AGG Intronic
901656634 1:10773318-10773340 CCGGCACACCTGAAGATCCGAGG - Intronic
904612774 1:31734501-31734523 CTTGCACACCTGCAGGGTCAGGG - Intronic
906149388 1:43578661-43578683 CTGGCACCCCTGCTGCTTCCAGG - Intronic
906305961 1:44719331-44719353 CTGGCACAAGGGCAATTTCGAGG + Intronic
907238421 1:53067178-53067200 CCGGCACACCTGCAGCTTCCAGG - Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909929363 1:81477600-81477622 CTGGCACTCCTGCAGTTTGTAGG + Intronic
915940108 1:160113654-160113676 TTTGCACACCTTCAGATTCGGGG + Intergenic
917964299 1:180168823-180168845 CTGGCCCACCAGCAGTCTCCAGG - Intronic
1063205408 10:3826352-3826374 CTGGCATCCCGGCAGTTTGGTGG + Intergenic
1064316035 10:14257517-14257539 CAGGTACACATGCATTTTCGAGG - Intronic
1069079013 10:64068194-64068216 ATGGCAGAACTGCAGTTTCCTGG + Intergenic
1070312942 10:75287024-75287046 CTGACCCACCTGCAGATTCCAGG - Intergenic
1076236126 10:128864867-128864889 CTGGTACAACTGCAGTTCTGGGG + Intergenic
1077341483 11:2028279-2028301 CTGGCCCTCGGGCAGTTTCGAGG + Intergenic
1081520915 11:43880544-43880566 CTTGGACATCTCCAGTTTCGAGG + Intergenic
1084191706 11:67502394-67502416 CAGGTACACCTGCCCTTTCGTGG - Exonic
1086220536 11:84437789-84437811 CTGACACACATGGAGTTTGGTGG - Intronic
1086539337 11:87889157-87889179 CAGGCACATCAGCAGTTTCCTGG - Intergenic
1202824469 11_KI270721v1_random:83468-83490 CTGGCCCTCGGGCAGTTTCGAGG + Intergenic
1096428003 12:51520657-51520679 CTCCCACACCTGCAGCTTCCTGG - Intergenic
1100789986 12:98119819-98119841 CTGCCACCCCTGCATTTTAGAGG + Intergenic
1104592704 12:130097586-130097608 CTGGTACATCTGCAGGTTCTTGG - Intergenic
1106979218 13:35256871-35256893 CTGGCATACCTGCACTCTTGGGG - Intronic
1112333546 13:98495998-98496020 CTGGCACAGCTGCAACTTCTGGG - Intronic
1113603881 13:111590915-111590937 CTTGCACATCTGCAGTTCCGAGG + Intronic
1114643671 14:24241666-24241688 CAGTCTCACCTGCAGCTTCGAGG + Exonic
1126949882 15:53869211-53869233 CTGGGTGACCTGCAGTTACGTGG + Intergenic
1129881319 15:79008135-79008157 CTGGCTCACCTGTTCTTTCGAGG + Intronic
1135736484 16:24935599-24935621 CTGGCACAGCTGCAGATACAGGG + Exonic
1139659429 16:68410833-68410855 CAGGAACACCTGCAGCATCGAGG + Intronic
1140045907 16:71440671-71440693 CTGGGACACCTGCAGCTGTGTGG - Intergenic
1142041687 16:87898262-87898284 CGGGCTCACCTGCAGCTTCTGGG - Intronic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142558534 17:795901-795923 CTGGCATCCCAGCACTTTCGAGG - Intergenic
1143336161 17:6173100-6173122 CTTGCACACCTTCAGTCACGGGG + Intergenic
1144672511 17:17140934-17140956 CTGTCCCACCTGCAGCTTCCAGG + Intronic
1147545470 17:41397963-41397985 CTGGTCCACCTGCCGTTTCTAGG + Intergenic
1152041210 17:77904502-77904524 ATGTCAAACCTGCAGATTCGTGG - Intergenic
1155606089 18:27607404-27607426 ATAGCACTGCTGCAGTTTCGAGG + Intergenic
1158552909 18:58452076-58452098 CTGGGACCCATGCAGTTTCTAGG + Intergenic
1164702950 19:30298684-30298706 CTGGCATACCTGCAGATATGGGG - Intronic
1165890175 19:39107187-39107209 CTGCAACACCTGCAATTTGGTGG + Intronic
929813278 2:45209991-45210013 CTGGCACATCTTCATTTTCTTGG + Intergenic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
932644743 2:73488469-73488491 CAGGCACCACTGCACTTTCGGGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
941906293 2:170717673-170717695 CAGGGAGACCTACAGTTTCGGGG + Exonic
948329916 2:237156611-237156633 CTGGCCCAGCTGCAGTGTGGGGG + Intergenic
1175408759 20:58752384-58752406 CTGGCACCCCTGCAGACTGGAGG - Intergenic
1176008564 20:62879984-62880006 CCTGCACCCCTGCAGTTTGGTGG - Exonic
1178718514 21:34988308-34988330 CTGGCATTGCTGCACTTTCGAGG + Intronic
949657556 3:6238318-6238340 CTGGCAGCGCTGCAGTTTTGGGG - Intergenic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
953607950 3:44424174-44424196 CAGGCACACTTCCAGTTTTGGGG - Intergenic
954273047 3:49524291-49524313 CTGGCACTTCTGCATTTTCAAGG - Intronic
960536697 3:118823121-118823143 GTAGCACAACTGCAGTTTCCAGG - Intergenic
961475265 3:127141961-127141983 CTGACTCACCTGCAGTCTCCCGG - Intergenic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
966940072 3:184740708-184740730 CACACACCCCTGCAGTTTCGTGG - Intergenic
969497573 4:7534891-7534913 CTGACACAGCTGCTGTTTTGAGG + Intronic
969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG + Intronic
969877241 4:10144889-10144911 TTGGTTCACCAGCAGTTTCGAGG - Intergenic
985358660 4:189148105-189148127 CTGCCACACCAGCAGATTTGTGG - Intergenic
988940309 5:36139100-36139122 CAGGCATCCCTGCACTTTCGGGG + Intronic
991260238 5:64659580-64659602 CTGGACCACATGGAGTTTCGGGG + Intergenic
993120578 5:83769178-83769200 CAGGAAAACCTGCAGTTTCTAGG - Intergenic
997362666 5:133305213-133305235 CTGGCATACCTGCAGTGATGGGG + Intronic
997516444 5:134493177-134493199 CTGGCACACCTGCAGTAACAGGG + Intergenic
1004807298 6:19217660-19217682 CTAGCACCACTGCAGTTTTGGGG - Intergenic
1006514184 6:34536920-34536942 CTGGCTCCCCTGCTGTTTCCTGG + Intergenic
1013063119 6:106656911-106656933 CTGTAACACCTGCACTTTGGAGG - Intronic
1014384618 6:120785719-120785741 CTGGCATCCCTGCACTTTCAGGG + Intergenic
1016989377 6:149918773-149918795 TAGTGACACCTGCAGTTTCGAGG + Intronic
1016993758 6:149946901-149946923 CAGTGACACCTGCAGTTTCAAGG - Intronic
1017004575 6:150020635-150020657 CAGTGACACCTGCAGTTTCAAGG + Intronic
1018741072 6:166729052-166729074 CTGGCACACCTGCTGTGGGGTGG - Intronic
1027460167 7:78441973-78441995 CTAGCCCAGCTGCAGTTTCAGGG + Intronic
1038372424 8:27007462-27007484 CTGGCCCATCTGCAGTCTCCAGG - Intergenic
1042612671 8:70615404-70615426 ATGGCACACCTGGAGCTTTGGGG + Intronic
1046981916 8:120345523-120345545 CTGGCACGCCTGCATTTCCGGGG - Exonic
1049804376 8:144532345-144532367 CTGGTCCACCTGCAGCTTCAGGG + Exonic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054953584 9:70882456-70882478 CCTTCACACCTGCAGTTTTGTGG - Intronic
1058183224 9:101823167-101823189 CTGGAATACCTGCAGCTTAGTGG - Intergenic
1061896542 9:133651506-133651528 CTGGAACACTTGCATTTTCTAGG - Intronic
1062540705 9:137040520-137040542 CTGGCTCACCTGCAGCTCCCCGG - Exonic
1185642113 X:1594071-1594093 CTTCCACACCTTCAGTTTCGGGG + Exonic
1189604922 X:42666848-42666870 TTTGCAAACCTGCAGTTTCATGG - Intergenic
1190217650 X:48490662-48490684 GTGGCACTCCTGCAGGTTCTGGG + Intergenic
1190266065 X:48827614-48827636 CTGGCGCAGCGGCAGTTTGGGGG - Intergenic
1195355866 X:104039690-104039712 GTGGCACACCTGCAGTGCAGTGG - Intergenic
1197732835 X:129826705-129826727 CTGGCACAGCTGGAGTTCTGGGG - Intronic